ID: 1190072477

View in Genome Browser
Species Human (GRCh38)
Location X:47290717-47290739
Sequence ACCAGATGGCTCCTATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190072477_1190072485 17 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072485 X:47290757-47290779 CAGAGGTATTGTGGGGAGAATGG No data
1190072477_1190072488 22 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072488 X:47290762-47290784 GTATTGTGGGGAGAATGGGTGGG No data
1190072477_1190072484 10 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072484 X:47290750-47290772 GGAGAATCAGAGGTATTGTGGGG No data
1190072477_1190072483 9 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072483 X:47290749-47290771 GGGAGAATCAGAGGTATTGTGGG No data
1190072477_1190072489 23 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072489 X:47290763-47290785 TATTGTGGGGAGAATGGGTGGGG No data
1190072477_1190072482 8 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072482 X:47290748-47290770 TGGGAGAATCAGAGGTATTGTGG No data
1190072477_1190072487 21 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072487 X:47290761-47290783 GGTATTGTGGGGAGAATGGGTGG No data
1190072477_1190072481 0 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072481 X:47290740-47290762 GTTTTAATTGGGAGAATCAGAGG No data
1190072477_1190072486 18 Left 1190072477 X:47290717-47290739 CCAGTCTATAGGAGCCATCTGGT No data
Right 1190072486 X:47290758-47290780 AGAGGTATTGTGGGGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190072477 Original CRISPR ACCAGATGGCTCCTATAGAC TGG (reversed) Intergenic