ID: 1190077615

View in Genome Browser
Species Human (GRCh38)
Location X:47329368-47329390
Sequence AAATTTTTTGGTGAGACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190077615_1190077623 7 Left 1190077615 X:47329368-47329390 CCCAGTGTCTCACCAAAAAATTT No data
Right 1190077623 X:47329398-47329420 ACTTACTTAAATACAGAAGGTGG No data
1190077615_1190077622 4 Left 1190077615 X:47329368-47329390 CCCAGTGTCTCACCAAAAAATTT No data
Right 1190077622 X:47329395-47329417 CAGACTTACTTAAATACAGAAGG No data
1190077615_1190077624 11 Left 1190077615 X:47329368-47329390 CCCAGTGTCTCACCAAAAAATTT No data
Right 1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG No data
1190077615_1190077625 12 Left 1190077615 X:47329368-47329390 CCCAGTGTCTCACCAAAAAATTT No data
Right 1190077625 X:47329403-47329425 CTTAAATACAGAAGGTGGCAGGG No data
1190077615_1190077626 20 Left 1190077615 X:47329368-47329390 CCCAGTGTCTCACCAAAAAATTT No data
Right 1190077626 X:47329411-47329433 CAGAAGGTGGCAGGGTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190077615 Original CRISPR AAATTTTTTGGTGAGACACT GGG (reversed) Intergenic
No off target data available for this crispr