ID: 1190077616

View in Genome Browser
Species Human (GRCh38)
Location X:47329369-47329391
Sequence GAAATTTTTTGGTGAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190077616_1190077625 11 Left 1190077616 X:47329369-47329391 CCAGTGTCTCACCAAAAAATTTC No data
Right 1190077625 X:47329403-47329425 CTTAAATACAGAAGGTGGCAGGG No data
1190077616_1190077622 3 Left 1190077616 X:47329369-47329391 CCAGTGTCTCACCAAAAAATTTC No data
Right 1190077622 X:47329395-47329417 CAGACTTACTTAAATACAGAAGG No data
1190077616_1190077623 6 Left 1190077616 X:47329369-47329391 CCAGTGTCTCACCAAAAAATTTC No data
Right 1190077623 X:47329398-47329420 ACTTACTTAAATACAGAAGGTGG No data
1190077616_1190077626 19 Left 1190077616 X:47329369-47329391 CCAGTGTCTCACCAAAAAATTTC No data
Right 1190077626 X:47329411-47329433 CAGAAGGTGGCAGGGTACAGTGG No data
1190077616_1190077624 10 Left 1190077616 X:47329369-47329391 CCAGTGTCTCACCAAAAAATTTC No data
Right 1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190077616 Original CRISPR GAAATTTTTTGGTGAGACAC TGG (reversed) Intergenic
No off target data available for this crispr