ID: 1190077624

View in Genome Browser
Species Human (GRCh38)
Location X:47329402-47329424
Sequence ACTTAAATACAGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190077617_1190077624 -1 Left 1190077617 X:47329380-47329402 CCAAAAAATTTCCCCCAGACTTA No data
Right 1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG No data
1190077614_1190077624 29 Left 1190077614 X:47329350-47329372 CCAACAAGCATAAGACAACCCAG No data
Right 1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG No data
1190077615_1190077624 11 Left 1190077615 X:47329368-47329390 CCCAGTGTCTCACCAAAAAATTT No data
Right 1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG No data
1190077616_1190077624 10 Left 1190077616 X:47329369-47329391 CCAGTGTCTCACCAAAAAATTTC No data
Right 1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190077624 Original CRISPR ACTTAAATACAGAAGGTGGC AGG Intergenic
No off target data available for this crispr