ID: 1190080656

View in Genome Browser
Species Human (GRCh38)
Location X:47354599-47354621
Sequence CTTCTCCCAACAGGAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190080656_1190080666 22 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080666 X:47354644-47354666 CCTAAGTTAAGGGATTGTCCAGG No data
1190080656_1190080667 27 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080667 X:47354649-47354671 GTTAAGGGATTGTCCAGGCCTGG No data
1190080656_1190080664 12 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080664 X:47354634-47354656 CTTCAAGGCACCTAAGTTAAGGG No data
1190080656_1190080662 -3 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080662 X:47354619-47354641 AAGGGAGTCTCTGGTCTTCAAGG No data
1190080656_1190080663 11 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080663 X:47354633-47354655 TCTTCAAGGCACCTAAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190080656 Original CRISPR CTTCTCCCAACAGGAAGCCT GGG (reversed) Intergenic
No off target data available for this crispr