ID: 1190080660

View in Genome Browser
Species Human (GRCh38)
Location X:47354608-47354630
Sequence AGAGACTCCCTTCTCCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190080660_1190080667 18 Left 1190080660 X:47354608-47354630 CCTGTTGGGAGAAGGGAGTCTCT No data
Right 1190080667 X:47354649-47354671 GTTAAGGGATTGTCCAGGCCTGG No data
1190080660_1190080663 2 Left 1190080660 X:47354608-47354630 CCTGTTGGGAGAAGGGAGTCTCT No data
Right 1190080663 X:47354633-47354655 TCTTCAAGGCACCTAAGTTAAGG No data
1190080660_1190080666 13 Left 1190080660 X:47354608-47354630 CCTGTTGGGAGAAGGGAGTCTCT No data
Right 1190080666 X:47354644-47354666 CCTAAGTTAAGGGATTGTCCAGG No data
1190080660_1190080664 3 Left 1190080660 X:47354608-47354630 CCTGTTGGGAGAAGGGAGTCTCT No data
Right 1190080664 X:47354634-47354656 CTTCAAGGCACCTAAGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190080660 Original CRISPR AGAGACTCCCTTCTCCCAAC AGG (reversed) Intergenic
No off target data available for this crispr