ID: 1190080662

View in Genome Browser
Species Human (GRCh38)
Location X:47354619-47354641
Sequence AAGGGAGTCTCTGGTCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190080656_1190080662 -3 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080662 X:47354619-47354641 AAGGGAGTCTCTGGTCTTCAAGG No data
1190080651_1190080662 15 Left 1190080651 X:47354581-47354603 CCAGTTTCACCTACTAGTCCCAG No data
Right 1190080662 X:47354619-47354641 AAGGGAGTCTCTGGTCTTCAAGG No data
1190080653_1190080662 6 Left 1190080653 X:47354590-47354612 CCTACTAGTCCCAGGCTTCCTGT No data
Right 1190080662 X:47354619-47354641 AAGGGAGTCTCTGGTCTTCAAGG No data
1190080657_1190080662 -4 Left 1190080657 X:47354600-47354622 CCAGGCTTCCTGTTGGGAGAAGG No data
Right 1190080662 X:47354619-47354641 AAGGGAGTCTCTGGTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190080662 Original CRISPR AAGGGAGTCTCTGGTCTTCA AGG Intergenic
No off target data available for this crispr