ID: 1190080666

View in Genome Browser
Species Human (GRCh38)
Location X:47354644-47354666
Sequence CCTAAGTTAAGGGATTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190080660_1190080666 13 Left 1190080660 X:47354608-47354630 CCTGTTGGGAGAAGGGAGTCTCT No data
Right 1190080666 X:47354644-47354666 CCTAAGTTAAGGGATTGTCCAGG No data
1190080656_1190080666 22 Left 1190080656 X:47354599-47354621 CCCAGGCTTCCTGTTGGGAGAAG No data
Right 1190080666 X:47354644-47354666 CCTAAGTTAAGGGATTGTCCAGG No data
1190080657_1190080666 21 Left 1190080657 X:47354600-47354622 CCAGGCTTCCTGTTGGGAGAAGG No data
Right 1190080666 X:47354644-47354666 CCTAAGTTAAGGGATTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190080666 Original CRISPR CCTAAGTTAAGGGATTGTCC AGG Intergenic
No off target data available for this crispr