ID: 1190092707

View in Genome Browser
Species Human (GRCh38)
Location X:47453448-47453470
Sequence CAGAATAAACAGATTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190092707 Original CRISPR CAGAATAAACAGATTCAGGG AGG Intronic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
907916984 1:58880202-58880224 CAGAAGAAACTGCTTCGGGGAGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
910584923 1:88869033-88869055 CAGAATACACAGATACAGGCCGG - Intronic
911545340 1:99209673-99209695 CATAAAAAACAGGTTCAGAGAGG + Intergenic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912461981 1:109840784-109840806 CAGAATAGACACATTTATGGAGG + Intergenic
913282900 1:117202410-117202432 GAGAAGAAAGAGCTTCAGGGAGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915907353 1:159888504-159888526 AAGAATAAACAGAGTTAGGGAGG + Intronic
916226381 1:162493906-162493928 GAGAATACATAGATACAGGGAGG + Intergenic
916549840 1:165839716-165839738 CAGAAGAAACAGATTAAAAGTGG - Intronic
916697349 1:167252498-167252520 CATTAAAAACAGATTCAGGCCGG - Intronic
918015802 1:180631858-180631880 CAGACTGAAGAGATCCAGGGAGG + Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920039946 1:203089074-203089096 ATGAATAAACACATTCGGGGTGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920600540 1:207320466-207320488 GAGAATACACAGACACAGGGAGG + Intergenic
921742185 1:218698008-218698030 CAGAGTATCCAGATTTAGGGAGG + Intergenic
921874427 1:220177927-220177949 CAGAATATACAGGTACAGGAAGG + Intronic
1063015462 10:2072351-2072373 AAGAAAAAATAAATTCAGGGTGG - Intergenic
1064531955 10:16319515-16319537 GAGAAGAAAGAGTTTCAGGGTGG - Intergenic
1065219138 10:23478054-23478076 CAGATTAAAGTAATTCAGGGGGG - Intergenic
1067664770 10:48267934-48267956 CAGAATAAACAAATCCATAGAGG + Intronic
1067665711 10:48276498-48276520 CAGGTTCAGCAGATTCAGGGTGG - Intergenic
1068350454 10:55837603-55837625 AAGGATAAACAGAGTTAGGGCGG + Intergenic
1068445801 10:57120867-57120889 AAGAATAAAAAGACTCAGGCTGG - Intergenic
1068457911 10:57282874-57282896 CAGAATTCATATATTCAGGGTGG + Intergenic
1069323004 10:67196780-67196802 CAAAATCAACAGATTCCTGGAGG - Intronic
1070332498 10:75428379-75428401 CAGAATTCACAGGCTCAGGGTGG + Intergenic
1070758456 10:79008185-79008207 AGGAGTAAACAGACTCAGGGTGG - Intergenic
1071971816 10:90915651-90915673 CAGAGTCAACAGGTTCAAGGTGG + Intronic
1072943572 10:99789223-99789245 CTGAATAAATAGATCCACGGAGG + Intronic
1073163415 10:101421452-101421474 AAAAATAAACAGACCCAGGGAGG - Intronic
1073324121 10:102632692-102632714 CAGAAGAGGCAGATTTAGGGAGG - Exonic
1073566671 10:104541187-104541209 CAGAAAAAAGAGGTCCAGGGAGG - Intergenic
1073696689 10:105877171-105877193 CAAAAAAAACAGACTCTGGGAGG + Intergenic
1073865422 10:107798331-107798353 CAGAATAAACATCTTCTGGGAGG + Intergenic
1073985781 10:109207381-109207403 CAGAATAAACAACTTCAGGGAGG + Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1075260732 10:120961993-120962015 CAGGACTAACAGATTCAGGCAGG + Intergenic
1075424536 10:122331303-122331325 CAGAAAAAACAAAGTCAGAGAGG - Intronic
1075904434 10:126068668-126068690 CAGAAGAAATAGATCCTGGGTGG - Intronic
1077622057 11:3734507-3734529 CAGAAGAAACAAATTTAGGGAGG + Intronic
1077803128 11:5561855-5561877 AAGACTAAACAGATTCAGAAAGG + Intronic
1078049942 11:7955013-7955035 AAGAAAAAAAAGTTTCAGGGAGG + Intergenic
1078469537 11:11575991-11576013 CAGAAGAAACTGGTTCAGAGAGG + Intronic
1080032617 11:27677966-27677988 TAGAAGAAACTGATTCAAGGTGG + Intronic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080898285 11:36463764-36463786 CAGGATAAAGAGATCCATGGTGG + Exonic
1081418754 11:42847005-42847027 GAGAATAAATAGTTTGAGGGAGG + Intergenic
1084100409 11:66944280-66944302 CAGAAAAAACAACTTCAGGCCGG + Intronic
1085269308 11:75260853-75260875 CATAAAAGACAGACTCAGGGAGG - Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086253872 11:84850674-84850696 TAGAATAAACAGATTCAGCAAGG + Intronic
1087749203 11:101988040-101988062 CAGAATAAACAGACCCAGAAAGG + Intronic
1088554447 11:111047698-111047720 CAGAATAGACAGTTTCTGTGTGG + Intergenic
1090088052 11:123668608-123668630 AACAAAGAACAGATTCAGGGTGG + Intergenic
1092242218 12:6842215-6842237 TTGAGTAAACAGACTCAGGGAGG + Intronic
1092355665 12:7792965-7792987 CTGAATAAGCAGATCCATGGAGG - Exonic
1093208461 12:16279616-16279638 CAGAAGAAAAAGTATCAGGGAGG - Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1094268601 12:28586636-28586658 GAGAATAAACAGAGACAGGTAGG - Intergenic
1095279854 12:40337468-40337490 CAGAAATAACAGATTCATAGTGG - Intronic
1095571602 12:43689181-43689203 AAGAGTAAACACATTCAGGGTGG - Intergenic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1099806281 12:87524156-87524178 AAGGATAAAAAGTTTCAGGGTGG - Intergenic
1100199835 12:92286497-92286519 AAGAAAAAAAAGGTTCAGGGAGG - Intergenic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101393183 12:104322156-104322178 CAGAAGAAACGGGTTCAGAGAGG - Intronic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102995757 12:117349165-117349187 CAGAATAGACAAATCCACGGAGG - Intronic
1103677209 12:122665226-122665248 CACAATAAAAAAATTCATGGTGG - Intergenic
1104310454 12:127650126-127650148 CAGAATCAGCACATTCAGAGAGG - Intergenic
1105447384 13:20469625-20469647 GAGAATAAACAGATACCGGAAGG - Intronic
1105998076 13:25692132-25692154 CAGGAGAAAGAGATTCACGGAGG + Intronic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1109173457 13:59125155-59125177 CATACTCACCAGATTCAGGGGGG + Intergenic
1110557008 13:76870849-76870871 CAGAATAAATAGATTCTGTATGG - Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1110785834 13:79524587-79524609 CATAGCAAACAGATTCAGGATGG + Intronic
1111409632 13:87857621-87857643 GAGACTAATCAGATTAAGGGTGG + Intergenic
1112238756 13:97660380-97660402 AATAATAAACAGAATCAGAGAGG - Intergenic
1113376441 13:109768746-109768768 CAGAAGATACAGAATCAGGCAGG + Intronic
1113970733 13:114186257-114186279 CAGGACAACCAGCTTCAGGGAGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1117249463 14:53921962-53921984 AAGAATAATCAGATACATGGTGG - Intergenic
1117540050 14:56738242-56738264 GTGAATAAACACATTCATGGAGG + Intergenic
1117593457 14:57301039-57301061 CATAAAAAATAGATTGAGGGTGG - Intergenic
1119837904 14:77767474-77767496 CAGAATAAACAAATCCTGTGGGG + Intronic
1121420562 14:93810442-93810464 CAGTGTATACAGCTTCAGGGTGG + Intergenic
1122250221 14:100433667-100433689 CAAAATAAACAGACTAATGGGGG - Intronic
1124013981 15:25861410-25861432 CAGAGTAAACGGGTTCAGAGAGG - Intronic
1125032300 15:35084922-35084944 CTGAATAAGCAGATCCATGGAGG + Intergenic
1126062657 15:44798810-44798832 CAGATTAAACAGTTCCAGTGTGG - Intergenic
1130336238 15:82959321-82959343 CAAGGTAAATAGATTCAGGGTGG + Intronic
1130801228 15:87265599-87265621 CAGAATGAACTCTTTCAGGGAGG - Intergenic
1131290713 15:91104551-91104573 CAAAATGTACAGATACAGGGAGG + Intronic
1133326090 16:4943262-4943284 TAGAATTAGCAGATTTAGGGAGG + Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134444159 16:14318204-14318226 CAGAATAAACAAATCCACAGGGG - Intergenic
1135029184 16:19024258-19024280 CAGAATAAACAGAATTAGCTGGG + Intronic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137754234 16:50888761-50888783 GAGAATAAACAGATCCAGCCTGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138929010 16:61629585-61629607 GTGAATAAATAGATTCAGAGAGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1140245383 16:73243812-73243834 CTGAATAATTAGATTCTGGGTGG - Intergenic
1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG + Intergenic
1141486927 16:84346625-84346647 AAGAATAAACTGATTGAGGCCGG - Intergenic
1141723227 16:85768459-85768481 CAGAACAATCAGATTCTGGGAGG + Intergenic
1145388625 17:22437298-22437320 CAGAAGAAAGAGTTTCAAGGAGG - Intergenic
1146273020 17:31496962-31496984 GAGAATACACAGGTTCAAGGAGG - Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1147529496 17:41262120-41262142 CAGAACACACAGACACAGGGAGG + Intergenic
1147860464 17:43518800-43518822 TAGAATAGACAAATTCAGAGAGG - Intronic
1148197932 17:45728223-45728245 CAGGATAGACAGACACAGGGAGG - Intergenic
1148348399 17:46920134-46920156 CACAATAAACATTTTCAGAGTGG + Intergenic
1149838166 17:59932849-59932871 AAGAATAAACTGATTCTGGCTGG - Intronic
1150193705 17:63271649-63271671 CAGAACACACAGACACAGGGAGG - Intronic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1155530011 18:26757519-26757541 TTGAACAAACAGCTTCAGGGGGG - Intergenic
1155689000 18:28593404-28593426 CTGAATAAACATATTTAGAGAGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156833890 18:41529310-41529332 CTGAATTAACAGATCCAGTGTGG + Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162083326 19:8233032-8233054 TAAAATAAAAAGATTCAGGCTGG - Intronic
1162369802 19:10271740-10271762 CAGAATATACATCTTGAGGGGGG - Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1167149274 19:47699462-47699484 CAGAAGAGTTAGATTCAGGGCGG + Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
928081980 2:28319873-28319895 CAGAATAGACAGGCTCACGGTGG + Intronic
931943723 2:67282089-67282111 GAGAATAAAAAGATTTGGGGGGG + Intergenic
932175154 2:69594045-69594067 AAGAATAAAAAGACTGAGGGAGG + Intronic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
933786003 2:85842065-85842087 CAGAGTTCACAGATTCAGGTGGG + Intronic
935352174 2:102160724-102160746 CAGCATAAACAGTTTCAGATTGG - Intronic
935467774 2:103419476-103419498 CAGCATATACAGATACAGGCTGG + Intergenic
935934020 2:108162408-108162430 CAGAATATAAAGTTTCAGGCAGG + Intergenic
937428456 2:121818525-121818547 AAACATAAACAGGTTCAGGGAGG - Intergenic
937540961 2:122952905-122952927 CAGAATAGACAAATTCATAGAGG + Intergenic
938194073 2:129310594-129310616 AAGAGCAAACAGATTCAGAGTGG + Intergenic
938580928 2:132645961-132645983 CAGAAGAAACTCACTCAGGGAGG + Exonic
939445349 2:142303135-142303157 CAGAAGAAAGAAATTCAGGAGGG - Intergenic
939869268 2:147508784-147508806 AAGAATACACAGTTTCAGGCTGG + Intergenic
940353254 2:152712493-152712515 CTGAATAAATAGAATTAGGGAGG + Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
944922963 2:204434605-204434627 CACAATAAACTAATTCAGAGTGG + Intergenic
945413196 2:209536913-209536935 CATAATGAACATATTCAGTGAGG - Intronic
946530269 2:220563249-220563271 CAGAATAGTCAAATTCAGAGAGG + Intergenic
947009310 2:225547892-225547914 AAGAATATACAGCTTGAGGGTGG - Intronic
947036438 2:225863453-225863475 TTGAATAAACAAATTCATGGAGG + Intergenic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
948244449 2:236467083-236467105 CATTATAAACACTTTCAGGGAGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169077649 20:2771279-2771301 AAGCATAAACAGATTCTGGGGGG + Intergenic
1170610688 20:17910452-17910474 CAGAATAAGCAGGTTTAGAGAGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1173473405 20:43340857-43340879 CAGAATAGGCAGATTCACAGAGG + Intergenic
1173894498 20:46540477-46540499 GAGAAGAAACAGATTCAGAGAGG - Intergenic
1174406091 20:50304374-50304396 CAGATGAAACAGGCTCAGGGAGG - Intergenic
1174511212 20:51054302-51054324 CAGAAGAAACAGACACAGAGAGG + Intergenic
1175109378 20:56635989-56636011 CAGATTGAAAAGATTCGGGGGGG - Intronic
1179410845 21:41162009-41162031 CAGCATAAACATTTTCAGGAAGG - Intergenic
1181679990 22:24488236-24488258 AAGAAACAACAGATTCAGGTTGG + Intergenic
1181851270 22:25751632-25751654 CAGAACAGACAGACTCAGAGAGG - Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950113762 3:10437394-10437416 CTGAGTAAACAGATTCTGAGAGG + Intronic
950215862 3:11158391-11158413 GAGAAGAAACAGGTTCAGAGGGG + Intronic
951915371 3:27795466-27795488 CATAGCAAACAGATTCAGGGTGG - Intergenic
952187645 3:30987750-30987772 CAGAATAAAAATATTAAGAGTGG + Intergenic
954514813 3:51164324-51164346 CAAAATAAAGAGATTCAGGCCGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
957735604 3:84197670-84197692 CAAAGTTAACAGATTCAGGTAGG - Intergenic
957738917 3:84237524-84237546 AAGAATAGACAGATTAAGGCGGG + Intergenic
958663604 3:97105140-97105162 GATAATAAACAAATTCAGAGTGG - Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959187223 3:103059682-103059704 CAATATAATCAGATTCAGAGAGG - Intergenic
959342986 3:105154857-105154879 CAGAATCCAAACATTCAGGGTGG - Intergenic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
961920325 3:130418524-130418546 CAAAATAAACACATTAGGGGAGG - Intronic
964219299 3:154325634-154325656 CAGAAAAAGGTGATTCAGGGAGG - Intergenic
964360611 3:155892072-155892094 TACAATAAACATATTTAGGGAGG - Intronic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969317025 4:6388542-6388564 CAGCACACACAGATACAGGGAGG + Intronic
971166496 4:24189319-24189341 CATAATAAAAAAATTGAGGGAGG + Intergenic
971319826 4:25596575-25596597 CAGAATACACATTTTCAGGCCGG + Intergenic
972447747 4:39161899-39161921 CATAATAAAAAGTTTCAGGCTGG - Intergenic
973913251 4:55605277-55605299 AAGAATGAAGAGATTCAGAGTGG - Exonic
973972293 4:56225496-56225518 AAGAAGAAACGGGTTCAGGGAGG - Intronic
974335524 4:60539539-60539561 CAGAATTAAGAGACTCAGGAAGG + Intergenic
974405197 4:61459276-61459298 CAGAATATACACATTCCAGGAGG - Intronic
975557556 4:75679763-75679785 TAGAATTCACAAATTCAGGGTGG - Intronic
976344602 4:83985812-83985834 CAAAATATAAAGATTCTGGGAGG + Intergenic
978079150 4:104570516-104570538 CAGATTAAATAGATTTAGGTTGG - Intergenic
979965553 4:127072538-127072560 CAAAAAAAACAGGTTCAAGGAGG + Intergenic
980969950 4:139558401-139558423 CAGAAGACACAGTTTCATGGTGG + Intronic
981561056 4:146048834-146048856 CAGAAGAGTCAGTTTCAGGGTGG - Intergenic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
982147187 4:152407727-152407749 CAGAATAAATAAATAGAGGGTGG - Intronic
982614033 4:157617269-157617291 CAGAATCAGCAAATTTAGGGTGG + Intergenic
983376883 4:166941123-166941145 CAGTTAAAACAGATTCAGGAGGG + Intronic
983509449 4:168591395-168591417 CAGGAAATACAGACTCAGGGAGG - Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984150690 4:176126501-176126523 CAGAACCCACAGATACAGGGTGG - Intronic
984463653 4:180069936-180069958 CGGGATAACCAGATTCAGGTAGG - Intergenic
984729425 4:183053661-183053683 CATTAAAAACTGATTCAGGGCGG - Intergenic
984850932 4:184152031-184152053 CAGCAGACACAGCTTCAGGGGGG - Intronic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
988404542 5:30807237-30807259 CAGCCAAAACAAATTCAGGGAGG - Intergenic
989685628 5:44083213-44083235 CAGAATAAATATATTCATGAAGG + Intergenic
990529289 5:56657774-56657796 CAGAGTAAACAGTTTCAGGTTGG + Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991520240 5:67489090-67489112 CAGATTATAGAAATTCAGGGAGG + Intergenic
992011657 5:72533295-72533317 CAGAAAGAACAGAGTCAGAGAGG + Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994355090 5:98785754-98785776 TATAATAAAAAAATTCAGGGAGG - Intronic
994747895 5:103701909-103701931 CACAATAAACACATCCAAGGTGG + Intergenic
995153410 5:108879436-108879458 GAGAACACACAGATACAGGGAGG - Intronic
996773577 5:127110407-127110429 CAGAAGGAGCAGTTTCAGGGAGG - Intergenic
996849683 5:127938123-127938145 CATAAGAAACTGATTCAGGTGGG - Intergenic
998624707 5:143833081-143833103 CAGGATCAACATATTCAGGAGGG + Intergenic
998987615 5:147778579-147778601 AAGTGGAAACAGATTCAGGGAGG - Intronic
999772687 5:154787374-154787396 CAGAATATACAGGTTCAGCTGGG - Intronic
1000396890 5:160785232-160785254 CAGAAAGTACAGATTCAAGGTGG - Intronic
1001088284 5:168717647-168717669 AAGAAAAGACAGATTCAGAGAGG - Intronic
1003592327 6:7446519-7446541 CACATTAAAGAGATTCATGGAGG + Intergenic
1004115896 6:12767751-12767773 CAGAGGAAAATGATTCAGGGTGG + Intronic
1005370026 6:25122819-25122841 CTAAGTCAACAGATTCAGGGTGG + Intergenic
1009829988 6:68918031-68918053 CAGAATATACAGATTCATAGAGG + Intronic
1009978106 6:70695148-70695170 TAGAATAAACAAATTCAGTAAGG - Intronic
1010199416 6:73269525-73269547 AAGCATAAAAAGATTCAGGCTGG - Intronic
1011243060 6:85293222-85293244 GAGAATACACAGACACAGGGAGG + Intergenic
1012453943 6:99383693-99383715 CAGAATAAAGAGTTTCAGGTGGG - Exonic
1013140443 6:107328570-107328592 CAGAAATAACAGTTTCAGGCTGG - Intronic
1013253474 6:108359074-108359096 CAAAATAGACAGATACAGGCTGG - Intronic
1014515007 6:122367293-122367315 AAAAATGAACAGGTTCAGGGTGG + Intergenic
1015277521 6:131399555-131399577 CAGAATCAGCAGATTCACAGAGG + Intergenic
1016455327 6:144224724-144224746 CAGAATAGAGAAATTCAGTGGGG - Intergenic
1018115862 6:160584626-160584648 CAGAAGTAACAAATTCAGGCTGG - Intronic
1018728862 6:166634178-166634200 CAGAGGAAGCAGATTCGGGGAGG + Intronic
1019912147 7:4107096-4107118 CCGAATACACACATCCAGGGTGG + Intronic
1021650381 7:22827273-22827295 GAAGATAAACAGATTTAGGGAGG - Intergenic
1022312728 7:29212466-29212488 CTGAATAAGCAGATCCATGGAGG - Intronic
1023185398 7:37527650-37527672 TAAAATTAACAGACTCAGGGAGG + Intergenic
1026152980 7:67803736-67803758 CAAAAAAAACAGGGTCAGGGTGG + Intergenic
1028763081 7:94517202-94517224 GAGAATGAAAAGTTTCAGGGAGG - Intronic
1029415773 7:100442272-100442294 CAGAAGGAAGAGATCCAGGGAGG + Intergenic
1029689995 7:102174962-102174984 CAAAAAAAACAGATAGAGGGAGG + Intronic
1030355484 7:108537955-108537977 CAGAAAATCCAGATTAAGGGTGG + Intronic
1030509544 7:110467712-110467734 CAGAATAAAAGCATACAGGGGGG - Intergenic
1030618107 7:111759770-111759792 CAGAATACAAATAATCAGGGTGG + Intronic
1030969339 7:116034952-116034974 GAGAATAAACAGTTTCAGTGGGG - Intronic
1032210707 7:129911396-129911418 CAGAACAAACAGGATGAGGGAGG + Intronic
1032401941 7:131629850-131629872 CAAAAGAAACAGATACATGGTGG + Intergenic
1032728841 7:134617543-134617565 CAGAATCAAGAGACTCAGAGAGG - Intergenic
1034042882 7:147897954-147897976 CAGAAGACACAGCTTCAGGGTGG + Intronic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1034571425 7:151959598-151959620 CAGAGGATACAGATTAAGGGAGG - Intronic
1036571189 8:9980911-9980933 AAAAATAAATAAATTCAGGGAGG - Intergenic
1036927056 8:12917219-12917241 CAGAATAAACTGATTCATGAAGG + Intergenic
1037212530 8:16408852-16408874 CAGAATAGGCAAATTCAGAGAGG + Intronic
1037921465 8:22809244-22809266 ACGAGGAAACAGATTCAGGGAGG + Intronic
1037958366 8:23076502-23076524 AAGAATGAACACATTCTGGGGGG + Intergenic
1038212666 8:25534029-25534051 CAGAATGTAATGATTCAGGGGGG - Intergenic
1038576973 8:28713059-28713081 CAAAATAAACAGGATGAGGGTGG - Intronic
1040691112 8:49939768-49939790 CAGAATAGAGAAATTGAGGGTGG - Intronic
1041164396 8:55076753-55076775 CACAGCAAACAGATTCAGGATGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1046380734 8:113446526-113446548 AAGAATAATCCCATTCAGGGTGG - Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1046829663 8:118730560-118730582 CAGTATAAACACATTGAGGGAGG - Intergenic
1047643001 8:126840562-126840584 CACAATAAAGAGAGTAAGGGAGG + Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1055598319 9:77888659-77888681 AAGAATAAACAGACTCAGTCTGG - Intronic
1056160000 9:83879673-83879695 GAGAATAAACAGACTCAGAGAGG + Intronic
1056281584 9:85046180-85046202 TATAATAAACAGATACAGGTGGG - Intergenic
1056360226 9:85850145-85850167 GAGAATAAACAGACTCAGAGAGG - Intergenic
1056905759 9:90646293-90646315 CTGAATCAACAGGTCCAGGGTGG - Intergenic
1059879646 9:118676157-118676179 CAGAATATATAGATTGAGAGTGG + Intergenic
1060458469 9:123824170-123824192 CAGAAGAAACAGGCTCAGAGAGG + Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1187269765 X:17769128-17769150 AAGATTCAACAGATGCAGGGAGG - Intergenic
1188059643 X:25585287-25585309 GAGAATACACAGATTCACAGAGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189177962 X:38976996-38977018 CACAATAAACAGATTTGTGGTGG - Intergenic
1190007295 X:46752628-46752650 CAGATTAAACACATACAGGAAGG + Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1191866678 X:65709463-65709485 CAGAAAAAACAGGTTCTGGTTGG + Intronic
1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG + Intergenic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1193298529 X:79861195-79861217 CAGAATAAACAAATTTATAGAGG - Intergenic
1193607446 X:83585617-83585639 CACAATTAACAGACACAGGGTGG + Intergenic
1194686368 X:96922806-96922828 CAGAAGAAACAGATATAGGTGGG - Intronic
1195118471 X:101724053-101724075 CAGAATAAGAAAATTCAGAGGGG - Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1196591254 X:117487554-117487576 CAGAATAAACAGAATAAAAGAGG + Intergenic
1197182035 X:123547263-123547285 CAGAAGAAACACCTTCAGGCTGG + Intergenic
1197597758 X:128487454-128487476 CAGATAAAACAGACTCAGAGAGG + Intergenic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1197971093 X:132115822-132115844 ATGAATAAACAGGTTCACGGTGG + Intronic
1198020576 X:132653564-132653586 CAGAGAAAACAGATTCAGAGAGG + Intronic
1198944540 X:141995885-141995907 AAGAATAGACTGCTTCAGGGTGG + Intergenic
1200153287 X:153962033-153962055 AAGGAAAGACAGATTCAGGGGGG - Intronic
1200375863 X:155779431-155779453 GAGAATAAATAGGTTCAGGAAGG - Exonic
1200627514 Y:5537799-5537821 GAGAAGCAACACATTCAGGGAGG - Intronic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic