ID: 1190099648

View in Genome Browser
Species Human (GRCh38)
Location X:47512826-47512848
Sequence CTGTGGGTCTCTTTTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190099643_1190099648 20 Left 1190099643 X:47512783-47512805 CCATTTGAACTAAGTAAACTGCC No data
Right 1190099648 X:47512826-47512848 CTGTGGGTCTCTTTTGCTTCTGG No data
1190099644_1190099648 -1 Left 1190099644 X:47512804-47512826 CCTAACGTATCTACATCCAAATC 0: 1
1: 0
2: 2
3: 19
4: 196
Right 1190099648 X:47512826-47512848 CTGTGGGTCTCTTTTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190099648 Original CRISPR CTGTGGGTCTCTTTTGCTTC TGG Intergenic
No off target data available for this crispr