ID: 1190100146

View in Genome Browser
Species Human (GRCh38)
Location X:47516534-47516556
Sequence AGTGACAAGATGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190100140_1190100146 8 Left 1190100140 X:47516503-47516525 CCTGACTCATCCCTCCATTTATT No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data
1190100138_1190100146 14 Left 1190100138 X:47516497-47516519 CCAGGCCCTGACTCATCCCTCCA No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data
1190100143_1190100146 -6 Left 1190100143 X:47516517-47516539 CCATTTATTCCAGTCACAGTGAC No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data
1190100139_1190100146 9 Left 1190100139 X:47516502-47516524 CCCTGACTCATCCCTCCATTTAT No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data
1190100137_1190100146 26 Left 1190100137 X:47516485-47516507 CCTTAGTCAATGCCAGGCCCTGA No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data
1190100141_1190100146 -2 Left 1190100141 X:47516513-47516535 CCCTCCATTTATTCCAGTCACAG No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data
1190100142_1190100146 -3 Left 1190100142 X:47516514-47516536 CCTCCATTTATTCCAGTCACAGT No data
Right 1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190100146 Original CRISPR AGTGACAAGATGAAGGAGAA AGG Intergenic
No off target data available for this crispr