ID: 1190101268

View in Genome Browser
Species Human (GRCh38)
Location X:47524361-47524383
Sequence GTTATCAAGTCACCCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190101263_1190101268 -9 Left 1190101263 X:47524347-47524369 CCCTGCACAAACCCGTTATCAAG No data
Right 1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG No data
1190101260_1190101268 20 Left 1190101260 X:47524318-47524340 CCTCGTGGAGCCAGGAGGGTCCT No data
Right 1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG No data
1190101261_1190101268 10 Left 1190101261 X:47524328-47524350 CCAGGAGGGTCCTCAGTGACCCT No data
Right 1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG No data
1190101264_1190101268 -10 Left 1190101264 X:47524348-47524370 CCTGCACAAACCCGTTATCAAGT No data
Right 1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG No data
1190101262_1190101268 0 Left 1190101262 X:47524338-47524360 CCTCAGTGACCCTGCACAAACCC No data
Right 1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190101268 Original CRISPR GTTATCAAGTCACCCCAAGT GGG Intergenic
No off target data available for this crispr