ID: 1190101931

View in Genome Browser
Species Human (GRCh38)
Location X:47528563-47528585
Sequence TAGGAGGACCACTTGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190101931_1190101936 -1 Left 1190101931 X:47528563-47528585 CCCCAGCTCAAGTGGTCCTCCTA No data
Right 1190101936 X:47528585-47528607 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
1190101931_1190101941 23 Left 1190101931 X:47528563-47528585 CCCCAGCTCAAGTGGTCCTCCTA No data
Right 1190101941 X:47528609-47528631 AATACAAGCGCCACCATGCCTGG No data
1190101931_1190101938 0 Left 1190101931 X:47528563-47528585 CCCCAGCTCAAGTGGTCCTCCTA No data
Right 1190101938 X:47528586-47528608 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190101931 Original CRISPR TAGGAGGACCACTTGAGCTG GGG (reversed) Intergenic
No off target data available for this crispr