ID: 1190106341

View in Genome Browser
Species Human (GRCh38)
Location X:47563453-47563475
Sequence ACATGTACCCTGCAGATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 21, 3: 84, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190106341_1190106344 -6 Left 1190106341 X:47563453-47563475 CCCCTTATCTGCAGGGTACATGT 0: 1
1: 1
2: 21
3: 84
4: 260
Right 1190106344 X:47563470-47563492 ACATGTTCCAAGACCCCCAGTGG 0: 6
1: 96
2: 306
3: 586
4: 784

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190106341 Original CRISPR ACATGTACCCTGCAGATAAG GGG (reversed) Intronic
902723622 1:18321178-18321200 ACATGGTCCCTGCAGACAAAAGG + Intronic
903235377 1:21947086-21947108 ACATGGACCCTGCAGATGCATGG + Intergenic
903756242 1:25663327-25663349 ACATATCTCCTGCAGGTAAGGGG - Intronic
904257297 1:29262684-29262706 ATGTGTCCCCTGCAGATATGGGG + Intronic
905045387 1:34994823-34994845 ACATATTCCCGGCAGATAAGGGG - Intronic
905195383 1:36272356-36272378 ACATGTACTCTGCTATTAAGTGG - Intronic
905765758 1:40599355-40599377 ACATATCCCCTGAGGATAAGTGG + Intergenic
906871863 1:49491817-49491839 ACATATTCCCTGAAGATAAGAGG - Intronic
908033130 1:60022492-60022514 ATATATACCCTGTGGATAAGGGG - Intronic
909345667 1:74583258-74583280 GTATATACCCTGCAGATAAGGGG - Intronic
912268940 1:108189956-108189978 AAATATGCCCTGCAGATAAAAGG + Intronic
913031389 1:114907220-114907242 ATATGTAGCCTGCATATAATTGG + Intronic
916033770 1:160902727-160902749 ACATATACCCTGAAGATAAGAGG - Intergenic
916063132 1:161115846-161115868 ATATGTCCCCCTCAGATAAGGGG + Intronic
917147691 1:171910497-171910519 ACATATCCCCTGCAGGTAAGGGG + Intronic
918111957 1:181463073-181463095 TCTTATCCCCTGCAGATAAGGGG - Intronic
918715127 1:187776507-187776529 ACATATCCCCTGCAGATAAAGGG + Intergenic
920617089 1:207504190-207504212 ACATGTCCCCCAAAGATAAGTGG + Intronic
921561577 1:216665320-216665342 ACACATCCCCTGCAGATAATGGG + Intronic
921755911 1:218855571-218855593 GCTTGTACCCTCCAGATAATTGG - Intergenic
922391023 1:225141500-225141522 ACATATTCCATGCAGATAAGGGG + Intronic
922823133 1:228498063-228498085 AAATGTTCCCTGGAGATCAGAGG - Intergenic
1064635812 10:17365710-17365732 AAATATCCCATGCAGATAAGGGG + Intronic
1064769508 10:18709734-18709756 ACGTGTCCCCTGCAGATGATGGG - Intergenic
1064965217 10:21008835-21008857 ACATATTCCCTGCAAATAAGGGG + Intronic
1065524290 10:26603132-26603154 ACACATCCTCTGCAGATAAGGGG - Intergenic
1065532104 10:26681745-26681767 ACACATCCTCTGCAGATAAGGGG - Intergenic
1066239919 10:33523518-33523540 TCATCTCCCCTGCAGATGAGCGG + Intergenic
1066480193 10:35788094-35788116 ACATACCCCCTGCAGATAAGAGG - Intergenic
1067175751 10:43944192-43944214 ACATGCACTCTGCAGCTTAGAGG - Intergenic
1067517197 10:46961412-46961434 ACATATCCCCTGCAGCTAAGGGG + Intronic
1067645051 10:48090417-48090439 ACATATCCCCTGCAGCTAAGGGG - Intergenic
1068628294 10:59272806-59272828 ACTTATCCCCTGCCGATAAGTGG - Intronic
1070798411 10:79230569-79230591 ACATGGACCCTGCACACAGGCGG - Intronic
1071866698 10:89742351-89742373 ACATATCCCCTGTGGATAAGGGG + Intronic
1073027255 10:100497109-100497131 GCCAGTACCCTGCAGAGAAGGGG + Intronic
1075196711 10:120365743-120365765 ACTTATTCCCCGCAGATAAGAGG - Intergenic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1076232251 10:128831132-128831154 ACATATTCCCTGAGGATAAGGGG - Intergenic
1078864431 11:15283518-15283540 ACAAATCCCCTGCAGATATGGGG - Intergenic
1078883202 11:15473793-15473815 ACACATCTCCTGCAGATAAGGGG - Intergenic
1079146312 11:17855429-17855451 ACATGTCCCCTGAAGATAAGGGG - Intronic
1079564356 11:21863778-21863800 GCATGTCTCCTGCTGATAAGGGG - Intergenic
1079960910 11:26921695-26921717 ATGTTTTCCCTGCAGATAAGGGG - Intergenic
1080396208 11:31892533-31892555 ACATATCTCCTGCAGATAAGGGG + Intronic
1080569955 11:33546723-33546745 ATAGATCCCCTGCAGATAAGAGG - Intronic
1080733798 11:34989334-34989356 AAGTATCCCCTGCAGATAAGGGG + Intronic
1082869776 11:57933524-57933546 CCATGTTTCCTGCAGGTAAGAGG + Intergenic
1083395236 11:62386579-62386601 ACGTATCCCCTGCAAATAAGGGG + Intronic
1083616443 11:64028776-64028798 ACCTGTGCCCGGCAGGTAAGTGG + Intronic
1085465223 11:76718641-76718663 ACATGTCCCCAGTGGATAAGGGG + Intergenic
1085546136 11:77319908-77319930 ACATATCTCCTGCAGATAAGCGG - Intergenic
1086018305 11:82194391-82194413 TCATATCCCCTGCAGATAATTGG - Intergenic
1086261146 11:84942685-84942707 ACATGTACTCTGCAGCCAATGGG + Intronic
1086544663 11:87953724-87953746 ACATATTACCTGAAGATAAGGGG + Intergenic
1087569912 11:99913057-99913079 ACATGTACCAAGAAGATAAATGG - Intronic
1088208250 11:107420578-107420600 ACATAACTCCTGCAGATAAGGGG - Intronic
1088615880 11:111627546-111627568 ACACAGCCCCTGCAGATAAGCGG + Intronic
1089881186 11:121775269-121775291 ACTTTTCCCCTGCAGATAAGGGG - Intergenic
1090454949 11:126841172-126841194 ACATATCCCCTGCAGATAAAGGG + Intronic
1090705895 11:129336243-129336265 ACATATGCCCTGTGGATAAGGGG + Intergenic
1090760265 11:129830956-129830978 ACATATCCCCTGCAGATAAAGGG - Intronic
1090856873 11:130617495-130617517 ACATATCCCCTACAGATAAGGGG + Intergenic
1090866278 11:130703675-130703697 CTTTGTACCCAGCAGATAAGAGG - Intronic
1091869560 12:3876953-3876975 ATGTATCCCCTGCAGATAAGGGG - Intergenic
1092195314 12:6546272-6546294 ACACATGCCCTGAAGATAAGGGG + Intronic
1099046410 12:77726394-77726416 ACAGGTGCCCTGCAAATAAATGG + Intergenic
1099871997 12:88361160-88361182 ACGTATCCCCTGCAGATAAGGGG - Intergenic
1100860448 12:98799958-98799980 ACTTGTACTCTGCAGAGACGGGG + Intronic
1101258840 12:103008451-103008473 ATATATTCTCTGCAGATAAGGGG + Intergenic
1101889500 12:108700119-108700141 AGATGTACCCTGAATATAAGGGG + Intronic
1102743819 12:115232032-115232054 ACATATGCCCTGCAGATAAGGGG - Intergenic
1103879564 12:124155568-124155590 ACATGTCCCCTGAGGATAACAGG - Intronic
1104800083 12:131548460-131548482 ACTTATCCCCTGCAGATAAAGGG - Intergenic
1105700038 13:22928887-22928909 ACACATCCCCTGCAGATAAAGGG + Intergenic
1105852813 13:24350800-24350822 ACATATATCCTGCAGACAACGGG + Intergenic
1106128245 13:26918973-26918995 TCATGTTCCCTGCAGATCTGTGG - Intergenic
1106291956 13:28371850-28371872 ACAGGTCCCCTGTGGATAAGGGG + Intronic
1106827478 13:33540107-33540129 ACATTTCCCCTGAAGCTAAGGGG - Intergenic
1108191611 13:47946322-47946344 ACACATTCCCTGCAGATAAGGGG + Intronic
1110799778 13:79681436-79681458 ATATATACCCTGCAGATAAGAGG - Intergenic
1111638247 13:90932834-90932856 ACATATTCCCTGAAGCTAAGGGG - Intergenic
1112072868 13:95874221-95874243 ACCTATACCCTGTGGATAAGTGG - Intronic
1112811524 13:103224235-103224257 ACACATTCCGTGCAGATAAGGGG - Intergenic
1114199729 14:20508880-20508902 ACATATTCCCTGTGGATAAGGGG + Intronic
1114755850 14:25258964-25258986 ACACATGCCCTGCAGATAAAAGG - Intergenic
1115342445 14:32306958-32306980 TCATATACCCCTCAGATAAGGGG - Intergenic
1117136264 14:52737150-52737172 ACATATCCCCTGTGGATAAGGGG + Intronic
1117199346 14:53372435-53372457 AAATGTAGCCTTTAGATAAGTGG + Intergenic
1117335266 14:54751993-54752015 ACAGGTACACTGCAGATAGTGGG + Intronic
1117601714 14:57382607-57382629 ACACACCCCCTGCAGATAAGGGG + Intergenic
1119894670 14:78209775-78209797 TCATGTACCTTGCTGAGAAGTGG + Intergenic
1121591024 14:95109785-95109807 CCATGGAGGCTGCAGATAAGCGG - Intronic
1122085850 14:99303626-99303648 ACATGTACTCTGTAGATATTGGG - Intergenic
1122841544 14:104466806-104466828 ACATATTGCCTGCAGATAAAGGG + Intergenic
1123832451 15:24154688-24154710 ACAAGTACACCTCAGATAAGGGG + Intergenic
1123847442 15:24316885-24316907 ACAAGTACACCTCAGATAAGGGG - Intergenic
1123866490 15:24524263-24524285 ACAAGTACACCTCAGATAAGGGG - Intergenic
1124344787 15:28914886-28914908 ACCTGTGCACTGCAGATAACAGG - Intronic
1126385420 15:48088862-48088884 ACATATCCCCTGCAGCTAAGGGG + Intergenic
1126497748 15:49311324-49311346 AATTGTATCCTGCAGATAAGTGG - Intronic
1126601129 15:50428449-50428471 ACATATCCCCTGCAGATAAGAGG - Intronic
1127079115 15:55358336-55358358 ACATATATCCTGAAGATAAGGGG + Intronic
1127407660 15:58668561-58668583 ACTTGAACCTTGAAGATAAGGGG - Intronic
1127491962 15:59473475-59473497 ACGTGTCCCCTGCAGATAAGAGG + Intronic
1128797774 15:70477932-70477954 ACATGAGCCCTGCAGAAAACTGG + Intergenic
1129056495 15:72824094-72824116 GCATGTACCCTAGAGATGAGAGG + Intergenic
1129784272 15:78298778-78298800 ACGTACACCCCGCAGATAAGGGG + Intronic
1131012021 15:89026050-89026072 ACATGGAACCTGCAGATACAGGG + Intergenic
1131088866 15:89603675-89603697 ACATATCTTCTGCAGATAAGGGG - Intronic
1131241801 15:90750899-90750921 ACATATTTCCTGAAGATAAGGGG + Intronic
1131327791 15:91465722-91465744 ACAGGGACCCCGCAGACAAGAGG - Intergenic
1131413581 15:92232135-92232157 ATATATCCCCTGCAGATACGGGG + Intergenic
1135678560 16:24438023-24438045 ACATGTATCCTGCTGATAACAGG - Intergenic
1137451800 16:48582763-48582785 ACGTATCCCCAGCAGATAAGGGG + Intronic
1138254330 16:55540729-55540751 ACATATCCCCTACAGATAAGGGG - Intronic
1139047453 16:63079392-63079414 ACATATACCCTGTAGATAAGGGG + Intergenic
1139240939 16:65391573-65391595 ACATATTCCCTACAGATAAGGGG + Intergenic
1140556677 16:75929516-75929538 ACATATCCCCTGCCGATAAGGGG + Intergenic
1143700385 17:8655319-8655341 ACTTATCCCCAGCAGATAAGAGG + Intergenic
1145783038 17:27576244-27576266 ACATATCCCCTACAGAAAAGGGG - Intronic
1147196919 17:38773069-38773091 ACATGTCCCCTGCTGATAAGGGG + Intronic
1147795708 17:43041127-43041149 ACATATGCCCCGCAGATAAGGGG - Intergenic
1147983402 17:44289291-44289313 ACATATTCTCTGAAGATAAGGGG - Intergenic
1148449244 17:47764245-47764267 ACATATCCCCTGCAGATAAGCGG + Intergenic
1149148862 17:53534538-53534560 ATATATCCCCTGCAGATAAGGGG - Intergenic
1150837457 17:68577260-68577282 TCATGTACCATGCAGAATAGAGG - Intronic
1151156796 17:72129954-72129976 TAATGTACCCTGCAGATATGAGG + Intergenic
1151357472 17:73568861-73568883 ACATGAAGCCTGCAGAGAGGTGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155357977 18:24972173-24972195 ACATAACCTCTGCAGATAAGAGG - Intergenic
1155408745 18:25518621-25518643 ACATATACCCTACTGATAAGGGG - Intergenic
1155750574 18:29417979-29418001 ACATATCCCCTGCAGGTAAGGGG - Intergenic
1158214956 18:55090860-55090882 ACATATCCCCTGCAGATAAGGGG - Intergenic
1158433245 18:57411578-57411600 ATGTATGCCCTGCAGATAAGGGG + Intergenic
1159919981 18:74219415-74219437 ACATATACCCTGGTGATAGGGGG + Intergenic
1160352867 18:78199969-78199991 AATTGTACCCTGCAGATGAGTGG + Intergenic
1160615813 18:80127247-80127269 ACATGTCCTTTGCAGATAAGGGG + Intronic
1164970479 19:32528005-32528027 ATATCTCCCTTGCAGATAAGAGG + Intergenic
1165676362 19:37727446-37727468 ACATAACCCCTGCAGATAAGAGG - Intergenic
1165897641 19:39152799-39152821 ACATACGCCTTGCAGATAAGGGG + Intronic
1168384228 19:55949617-55949639 ACATAGACCCTGCAGAGAAGGGG + Intronic
1168683021 19:58329842-58329864 ACACATCCCCTGCAGATAAGGGG + Intronic
926846225 2:17143416-17143438 ACATATTCCCTGCAGAGAAGAGG - Intergenic
929573123 2:43035545-43035567 CCATGTCCCCTGAAGATAAGAGG + Intergenic
930149762 2:48046607-48046629 ACATGAACATTGCAGAAAAGAGG + Intergenic
930235160 2:48882299-48882321 TCATGTCACCTGCAGATATGAGG - Intergenic
930249892 2:49023454-49023476 ACATGTTGCCTGCAGAAAAGGGG - Intronic
930474402 2:51862349-51862371 GCAGATATCCTGCAGATAAGGGG - Intergenic
931076082 2:58714279-58714301 ACGTATGCCCTGCGGATAAGGGG - Intergenic
932431780 2:71679943-71679965 ACATATCTCCTCCAGATAAGGGG - Intronic
932900316 2:75691083-75691105 AGGTGTCCCCTGCAGATTAGGGG - Intronic
933196966 2:79402368-79402390 ACACATCCCCTGCAGATAAAGGG - Intronic
934863817 2:97788180-97788202 ACTTGTACCCTGCAGCCCAGTGG - Intronic
938633851 2:133200898-133200920 ACATATTCCCTGTGGATAAGCGG - Intronic
938653147 2:133404322-133404344 ATATATCCCCTGCAGATAAGGGG - Intronic
938890551 2:135700878-135700900 ACATATACCCTCTGGATAAGGGG - Intronic
939606490 2:144261555-144261577 ACATATGCCCTGCAAAAAAGTGG + Intronic
940016119 2:149106920-149106942 GCACATCCCCTGCAGATAAGGGG - Intronic
941391408 2:164919896-164919918 ACATACACCCTATAGATAAGGGG - Intronic
941621576 2:167785008-167785030 AGATGTACACGGCAGATGAGTGG - Intergenic
941829727 2:169941762-169941784 ACGTGTTCCCTGAAGATAAGAGG + Intronic
941931082 2:170939725-170939747 ACATATCCCCTGCAGATAACAGG + Intronic
942352905 2:175072097-175072119 CCAAGTACCCTGCAGTTAAAAGG + Intergenic
942841783 2:180370458-180370480 ACATGTACTGTGCAGATTAAGGG + Intergenic
943702498 2:191001808-191001830 AGATGTACCCTGCACATACTAGG + Intronic
943826616 2:192402482-192402504 ACATATCTCCTGCAGATAAGAGG - Intergenic
945234077 2:207618271-207618293 ACATATCCCTTGCAGATAAGAGG - Intronic
945528352 2:210918582-210918604 ACATATTCCCTGCAGATAAGGGG - Intergenic
945957503 2:216099905-216099927 CTTTGTACCCTGCAGATATGTGG + Exonic
946220682 2:218223552-218223574 ACATATCCCCCACAGATAAGGGG + Intronic
946265611 2:218538817-218538839 ACATGTACCCTGAAGATAAGGGG - Intronic
946719856 2:222593091-222593113 ATGTATACCCTGCAGATAAGAGG + Intronic
946724140 2:222644634-222644656 ACATATCCCCTGTGGATAAGGGG - Intronic
947740774 2:232483891-232483913 ACATGTCCCCTGCAGGCAGGGGG - Intronic
948497284 2:238359747-238359769 ACATATCCCCTGCAAATAAGAGG - Intronic
1169581944 20:7033593-7033615 GCATATACCTTCCAGATAAGGGG + Intergenic
1172397080 20:34615820-34615842 ACATATCCCCTGCAGACATGGGG + Intronic
1175844038 20:62049305-62049327 ACATGTGCCCTGCAGGGCAGTGG + Intronic
1177620545 21:23586019-23586041 ATGTGTATCCTGCAAATAAGGGG + Intergenic
1178209690 21:30515536-30515558 ACATATACCCTGTGGATAAGAGG - Intergenic
1180012695 21:45061530-45061552 ACATATTCCCCACAGATAAGAGG + Intergenic
1180825680 22:18859287-18859309 ACATGAGCCCTGCTGATGAGGGG - Intronic
1180904041 22:19396018-19396040 ATATGCACCCTGCAGTTCAGGGG - Intronic
1182725014 22:32438104-32438126 ACATATGCCCTGCAGATAAGGGG - Intronic
1203214807 22_KI270731v1_random:199-221 ACATGAGCCCTGCTGATGAGGGG + Intergenic
1203324940 22_KI270738v1_random:4682-4704 ACATGGACCGTGGAGGTAAGGGG - Intergenic
950818844 3:15736364-15736386 ACATATCCTCTGTAGATAAGTGG + Intronic
951745464 3:25973023-25973045 ACATATCCCCTGTGGATAAGGGG + Intergenic
953005002 3:38969977-38969999 ACATCTGCGCTGCAGATAAAAGG - Intergenic
954281465 3:49581895-49581917 ACATATCCCCTGAGGATAAGTGG + Intronic
957443519 3:80284984-80285006 AAATGTAGCCTGCAAATAAAGGG - Intergenic
959403226 3:105928947-105928969 ACTTATTCCCTCCAGATAAGAGG + Intergenic
959411931 3:106035232-106035254 ACATGTCCCCTGTGGTTAAGAGG + Intergenic
959949146 3:112159927-112159949 ACATGTACACTGAAAATGAGAGG - Intronic
960645321 3:119874219-119874241 ACATATCCCCTGTAGATAAAAGG - Intronic
960839550 3:121942850-121942872 ACATGTACGCTGCAGAACATTGG + Exonic
961637413 3:128342150-128342172 ACATCTACCATGTAAATAAGTGG - Intronic
963220725 3:142808808-142808830 ACATATCCCCTGTGGATAAGGGG + Intergenic
963269433 3:143271182-143271204 ACATATCCCCAGCAGATAAGGGG + Intronic
964015651 3:151942857-151942879 ACATATCCCCTGAGGATAAGGGG + Intergenic
964369926 3:155989603-155989625 ACATATCCCCTGCAGGTAACAGG - Intergenic
964448990 3:156791805-156791827 ACATGTAGACTTCAGATAAGGGG + Intergenic
966034474 3:175394671-175394693 GCATATCCCCTGCAGATAAGGGG - Intronic
967178437 3:186882624-186882646 ACATATGCCCCCCAGATAAGAGG - Intergenic
967662475 3:192130050-192130072 ACATATTCCCCACAGATAAGGGG - Intergenic
968150306 3:196332638-196332660 ACATATCCCCTGCAGATATGGGG - Intronic
968272689 3:197416628-197416650 ATATGTGCCCTTTAGATAAGAGG - Intergenic
969130587 4:4988144-4988166 ACATATCCCCTGCAGATAAGGGG - Intergenic
970105229 4:12575157-12575179 ATATGGACCCTGCAGAAAGGAGG + Intergenic
971884162 4:32422308-32422330 ACATATTCCCTGCAGATAAGCGG + Intergenic
972504691 4:39709654-39709676 ACGTGTCCCCTGTGGATAAGAGG + Intronic
973291828 4:48478566-48478588 ACATATTCCCTGAGGATAAGGGG - Intergenic
973662959 4:53126714-53126736 ACTTGTACTCTGTAGTTAAGTGG - Intronic
974088242 4:57283670-57283692 ACATATTCCCCGCAAATAAGGGG - Intergenic
974572460 4:63670518-63670540 ACTTATTCCCTGCAGATAAAAGG - Intergenic
975676206 4:76830429-76830451 ACACATCCCCTGCAGATAAAAGG + Intergenic
977119042 4:93073671-93073693 GCATGTACCCCATAGATAAGAGG - Intronic
977924475 4:102684640-102684662 GCGTATCCCCTGCAGATAAGGGG - Intronic
979355973 4:119706249-119706271 ATATATGCTCTGCAGATAAGGGG - Intergenic
979769629 4:124507044-124507066 ACATGTAAGTGGCAGATAAGAGG + Intergenic
980437794 4:132801715-132801737 ATATCAACCCTGCAGAAAAGGGG - Intergenic
980517315 4:133879412-133879434 ACACGTCTCCTGCGGATAAGGGG - Intergenic
980663081 4:135892911-135892933 ACACATTCCCTGCAGATAAAGGG + Intergenic
982663678 4:158234590-158234612 ACATATTCCCTGTGGATAAGGGG - Intronic
982791643 4:159598941-159598963 ACATGTAGCCTGCACAAGAGAGG - Intergenic
982911105 4:161144114-161144136 ACTTGTACCCTCCAGAACAGTGG - Intergenic
984285049 4:177718555-177718577 ACATTTCCCCTGCAGATGAGGGG - Intergenic
985789159 5:1916106-1916128 ACCTGTACCCTGCTGAGAGGAGG + Intergenic
986252741 5:6075588-6075610 ACATTTACCCTGCATATGAGAGG - Intergenic
986409940 5:7467353-7467375 TCATGCACCCTGCAGAGAAAGGG - Intronic
987552742 5:19405147-19405169 ACATTTGCCCTGCAGACAAGTGG + Intergenic
987884663 5:23798613-23798635 AAAGGAACCCTGCAGATAAATGG + Intergenic
988280370 5:29137947-29137969 TTATGTAACCTGCAGATAATAGG + Intergenic
988844927 5:35118053-35118075 ACATGAACCCTGAAGGTAAGGGG - Exonic
988946046 5:36201052-36201074 ACTTGTCCCCTGCGGATAAGAGG + Intronic
990862151 5:60338891-60338913 ACATATGCCCTGCAGATAATGGG - Intronic
990885852 5:60592753-60592775 ACATATCCCTAGCAGATAAGGGG - Intergenic
991057137 5:62333745-62333767 ACAATTTCCCTGCAGAGAAGGGG + Intronic
991240779 5:64457736-64457758 ACATATTCCCCACAGATAAGAGG - Intergenic
991306624 5:65183560-65183582 ACATGTCCCCTGTGGATAAGGGG + Intronic
991397110 5:66215761-66215783 CCATATTTCCTGCAGATAAGTGG - Intergenic
992483882 5:77177262-77177284 ACATATCCCTTGCGGATAAGGGG - Intergenic
993217013 5:85038268-85038290 ATATCTTCCCTGCAGATAAGGGG - Intergenic
993468903 5:88282589-88282611 ACACATTCCCTGCAGATAAGTGG - Intergenic
994030225 5:95133203-95133225 ACATATCCCCTGTAGATAAAGGG - Intronic
994228173 5:97279184-97279206 ATGTATCCCCTGCAGATAAGTGG + Intergenic
995789863 5:115874798-115874820 ACATGTTGCCTACAGACAAGAGG + Intronic
996683423 5:126253719-126253741 CCCTTAACCCTGCAGATAAGTGG + Intergenic
997047266 5:130332753-130332775 ACATATCCCCTGTAGATAAGAGG - Intergenic
997909740 5:137858730-137858752 ATGTGTCCCCTGCAGATAAGGGG + Intergenic
999990428 5:157044997-157045019 ACATATCCCCTGTGGATAAGGGG - Intronic
1000172137 5:158712623-158712645 AGATGTACCCTGGAGTTAACAGG + Intronic
1002270043 5:178065529-178065551 ACATACACCCCGCAGATAAGGGG + Intergenic
1003070432 6:2941206-2941228 ACATATCCCTTGCAGGTAAGGGG - Intergenic
1004308132 6:14519651-14519673 ACATATCTCCTGCAGATAAGGGG - Intergenic
1004324260 6:14659556-14659578 TCTTGTACCCTCCAGAAAAGAGG - Intergenic
1004654892 6:17649894-17649916 ACATATCCCTTGCAGATAAGGGG + Intronic
1004775560 6:18840743-18840765 TCAGGAACCATGCAGATAAGAGG - Intergenic
1005354846 6:24972501-24972523 ACATTTACCCTGAAGAAGAGAGG + Intronic
1007003621 6:38338107-38338129 ACATATCCCCTGCAGATAAGGGG - Intronic
1008843618 6:55935447-55935469 ACATGTAGCATGCAGGTAAATGG - Intergenic
1009285744 6:61814753-61814775 TCATATCCCCAGCAGATAAGGGG - Intronic
1010408575 6:75534761-75534783 ACATATCCCCTGAGGATAAGTGG - Intergenic
1010698041 6:79002659-79002681 ACATATTCCCTGTGGATAAGAGG + Intronic
1010715693 6:79227115-79227137 AATTGTACCCTGCAGGAAAGTGG + Intronic
1011375819 6:86685717-86685739 ACATATCCCCTGTGGATAAGGGG + Intergenic
1012188057 6:96246438-96246460 ACATATCCCCTGTGGATAAGAGG - Intergenic
1012556595 6:100521180-100521202 ATATATTCCCTACAGATAAGGGG - Intronic
1013489180 6:110628653-110628675 ACATATTCCCAGCAGATAAGTGG + Intronic
1013865623 6:114692853-114692875 ACATGTCCCCCACAGATAAAGGG - Intergenic
1014131845 6:117844294-117844316 GCATGTACCATGCAGACAACAGG - Intergenic
1015042458 6:128738616-128738638 ACATATTCCCTGCAGATAAGAGG - Intergenic
1015102037 6:129492782-129492804 ACATCTACTATGCAGATAAAAGG - Intronic
1015598950 6:134893935-134893957 ACATATCCCCCGCAGATAAGGGG + Intergenic
1015675279 6:135739367-135739389 ACGTATACTCTGCAGATAAGAGG - Intergenic
1017079166 6:150650926-150650948 ACATATTCCCCACAGATAAGGGG - Intronic
1017096173 6:150807289-150807311 ACATATCCCCTGCAGATAAGAGG + Intronic
1018427423 6:163695883-163695905 ATACATCCCCTGCAGATAAGTGG - Intergenic
1018878998 6:167856386-167856408 ACATGTTCCCTACAGATAAGGGG + Intronic
1020938084 7:14493238-14493260 ATGTATACCCTGTAGATAAGGGG - Intronic
1021394577 7:20131459-20131481 ATGTATCCCCTGCAGATAAGGGG - Intergenic
1022221538 7:28319002-28319024 ACATTTAACATACAGATAAGCGG - Intronic
1023068611 7:36404320-36404342 ACATATACCCAGCGGATAAGTGG - Intronic
1025163538 7:56688550-56688572 ACAAAAACCCTGCAGACAAGAGG + Intergenic
1025240928 7:57273013-57273035 ACAAAAACCCTGCAGACAAGAGG - Intergenic
1025478725 7:60957253-60957275 ATATGGACCCTGCAGGTAAGGGG + Intergenic
1025553333 7:62275440-62275462 ATATGGACCCTGCAGGTTAGGGG - Intergenic
1025963970 7:66250586-66250608 ACATATCATCTGCAGATAAGGGG - Intronic
1026353863 7:69540574-69540596 CCATCTACCTTGCAGAAAAGGGG + Intergenic
1027827373 7:83133864-83133886 ACATGTAAACTCCAGATAAAAGG - Intronic
1028031154 7:85914820-85914842 ACATGTATCTTGCAGAAAAAGGG - Intergenic
1030341038 7:108381254-108381276 ACATGTTCACTGCAGACAATTGG - Intronic
1030518643 7:110568646-110568668 ACATACACCCAGCAGATAATGGG - Intergenic
1030631017 7:111895899-111895921 AAATGTAAGTTGCAGATAAGGGG - Intronic
1030773985 7:113511257-113511279 ACATATCCTCTGCAAATAAGTGG - Intergenic
1031376314 7:121030826-121030848 ACATATCTCCTGCAGATAAGGGG + Intronic
1031926668 7:127645048-127645070 ACATATACCTTTCAGATAAGGGG + Intergenic
1033825306 7:145182652-145182674 ACATATCCCCTGAACATAAGGGG - Intergenic
1035052450 7:156007229-156007251 GCATGTCCCCTGCAGACAATGGG + Intergenic
1037209956 8:16375015-16375037 ACAGGTACCCTGCAGGTCAAGGG + Intronic
1037563907 8:20100305-20100327 CCAGTTACCCTGCAAATAAGTGG - Intergenic
1037843290 8:22260796-22260818 ACTTGTCCCCTGCAGATAGGAGG - Intergenic
1039574283 8:38611168-38611190 ACATGTGGCCTGCAGAGTAGGGG + Intergenic
1039786524 8:40839013-40839035 AAATGTACCCTGTACATAAAAGG + Intronic
1040053610 8:43038742-43038764 ACATGTACAATGCAGTTCAGTGG - Intronic
1042223711 8:66498510-66498532 ACATATTTCCTGCAGATAAGGGG - Intronic
1042302988 8:67305769-67305791 ATATATCCCCTGCAGATAAGGGG - Intronic
1042389193 8:68213595-68213617 AAATGTAACCTGCAGCTAATGGG - Intronic
1042793119 8:72630922-72630944 ACGTATCCCCTGTAGATAAGGGG - Intronic
1043282666 8:78487794-78487816 ACATATCCCCTGCAGATAAGGGG - Intergenic
1044472471 8:92585853-92585875 GCATATCCCTTGCAGATAAGAGG + Intergenic
1044782732 8:95760124-95760146 ATGTATTCCCTGCAGATAAGGGG + Intergenic
1045062246 8:98420532-98420554 ATGTATCCCCTGCAGATAAGGGG + Intronic
1045718909 8:105082556-105082578 ACGTATACCCTGAAGATAAGGGG + Intronic
1047452929 8:124982741-124982763 ATGTGTCCCCAGCAGATAAGGGG + Intergenic
1047572476 8:126114605-126114627 CCATATACCCTGTAGATAAGGGG + Intergenic
1048038514 8:130701495-130701517 ACATATTCCCTGCCAATAAGGGG + Intergenic
1048184660 8:132228874-132228896 GCATTTATCTTGCAGATAAGAGG + Intronic
1049140896 8:140953163-140953185 GCATATCCCCTGCAGATAAGTGG - Intronic
1049592721 8:143469880-143469902 AAATGGACACTGCAGTTAAGAGG + Intronic
1050496122 9:6244343-6244365 ACATATTTCCTGCAAATAAGAGG - Intronic
1050528971 9:6571239-6571261 AGATATTTCCTGCAGATAAGAGG - Intronic
1051068662 9:13135895-13135917 ACAAGTACTCTTCACATAAGTGG + Intronic
1051134411 9:13902178-13902200 ACACATCCCCTGCTGATAAGGGG + Intergenic
1051495011 9:17710824-17710846 ACATACCCCTTGCAGATAAGAGG - Intronic
1052566002 9:30152687-30152709 ACATGTACACTGAAAATAAAGGG - Intergenic
1052606763 9:30714016-30714038 ACATATTCCCTGCATTTAAGTGG + Intergenic
1052897885 9:33765153-33765175 ACATATCCCCTGCAGATAAAGGG - Intronic
1054884074 9:70176874-70176896 ACATATGCCCTGCAGATAAGGGG - Intronic
1055131898 9:72785164-72785186 ACATATCCCCTGAAGACAAGAGG - Intronic
1055541395 9:77309422-77309444 ACATATTCCCTGCAGATAAAAGG - Intronic
1056902951 9:90617630-90617652 AGAAGGACCATGCAGATAAGGGG + Intronic
1057614318 9:96575107-96575129 ACATGTCCTCCGGAGATAAGAGG + Intronic
1058353118 9:104050770-104050792 ACATGTACACTGTAGATTACAGG + Intergenic
1058990724 9:110253726-110253748 ACATGAAGCCTGCACATACGTGG - Intronic
1059096685 9:111423966-111423988 AGATGTCACCTGCAGGTAAGGGG + Intronic
1060296109 9:122343924-122343946 ACATGTAACCTGCATACATGTGG - Intergenic
1060394781 9:123308091-123308113 ACATATTCTCTACAGATAAGGGG - Intergenic
1061893710 9:133636088-133636110 AGATGCACCCTGCAGCCAAGAGG - Intergenic
1062355771 9:136161311-136161333 TCATCTCCCCTGCAGATGAGGGG - Intergenic
1186654959 X:11602513-11602535 ACTTGTAGCCTGGAGGTAAGTGG - Intronic
1187895107 X:23973437-23973459 GCATGTACCCTGAAGACAACAGG + Intergenic
1187908278 X:24087369-24087391 ATATATGCCCTGCAGGTAAGGGG - Intergenic
1187913831 X:24134714-24134736 GCATGTACCCTGAAGACAACAGG + Intergenic
1188144930 X:26599878-26599900 ACATATCCCCTGTGGATAAGGGG + Intergenic
1188488233 X:30706584-30706606 ACATGTGCCAGGCAGATAAGTGG - Intronic
1188820932 X:34774301-34774323 AGATATACACTTCAGATAAGTGG - Intergenic
1189541446 X:41995212-41995234 ATATATCCCCTGCAGGTAAGAGG - Intergenic
1189737189 X:44083569-44083591 ACATATCCCCTGCAAATAAGGGG + Intergenic
1190106341 X:47563453-47563475 ACATGTACCCTGCAGATAAGGGG - Intronic
1190919315 X:54836733-54836755 ACATGTAGACTGCAAATAAAGGG - Intergenic
1192399010 X:70815696-70815718 ACATGTCCCCCACGGATAAGGGG + Intronic
1193960887 X:87923980-87924002 ACATGACCCCTGCAGAAAAGGGG + Intergenic
1194172643 X:90606492-90606514 ACATATCCCCTGTAGGTAAGGGG - Intergenic
1194681119 X:96854454-96854476 ACATATTCCCTGTGGATAAGGGG - Intronic
1194691144 X:96986696-96986718 ACATGTACCCTGAAATTAATAGG + Intronic
1195206893 X:102610456-102610478 ATATGTTCCATGCAGATATGGGG - Intergenic
1196723364 X:118875293-118875315 ACTTGTACCCTCCAGAGCAGTGG - Intergenic
1197627524 X:128819200-128819222 ACATATCCCCAGCAAATAAGGGG + Intergenic
1198646859 X:138817516-138817538 ACATGCACCCTACAGATAAGTGG - Intronic
1198652153 X:138874720-138874742 CAATGTTCCCTGCAGAGAAGAGG - Intronic
1199493977 X:148432640-148432662 ATATGTACACTACAGAAAAGAGG + Intergenic
1199595405 X:149502970-149502992 ACAGGTACCCTGCAGGGGAGAGG + Intronic
1199598474 X:149526243-149526265 ACAGGTACCCTGCAGGGGAGAGG - Intronic
1200518871 Y:4184229-4184251 ACATATCCCCTGTAGGTAAGGGG - Intergenic
1201276787 Y:12306089-12306111 ACATGTAGCCTGCAGTTAGCAGG + Intergenic