ID: 1190106452

View in Genome Browser
Species Human (GRCh38)
Location X:47564557-47564579
Sequence AAGGGTAATGAGAGGCATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190106452 Original CRISPR AAGGGTAATGAGAGGCATGA CGG (reversed) Intronic
902206099 1:14869179-14869201 AAGGGTCAAGACAGGCAGGAAGG - Intronic
902210169 1:14899295-14899317 AAGGGTAATGAGGGCCCAGAGGG - Intronic
903285632 1:22275143-22275165 GGGGGCAAGGAGAGGCATGATGG - Intergenic
903513834 1:23896623-23896645 GAGGGAGATGAGAGGCAGGAGGG + Intronic
904434934 1:30488471-30488493 AATGGTAATGAGAGTGATGATGG + Intergenic
904611649 1:31729115-31729137 GAGGGCCAGGAGAGGCATGAGGG - Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905485677 1:38294340-38294362 AAGGGTAGTGAGAGGACAGATGG - Intergenic
906305791 1:44718326-44718348 AAGTGTCATCAGATGCATGAGGG + Intronic
906703471 1:47876771-47876793 AAGAGTAAACAGAGACATGAAGG - Intronic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
909511721 1:76460927-76460949 ATGGGTAAAGAGAGGAATGGTGG + Intronic
911006977 1:93236536-93236558 AAGCATAATGAGAGATATGAAGG - Intronic
911035060 1:93533831-93533853 AAGGGTAATTAGAGAGAAGAGGG - Intronic
911220783 1:95242954-95242976 AAGGGTTTTGAGAAACATGATGG + Intronic
911941561 1:104053936-104053958 AATGGTAAAGAGAGTCATGTAGG - Intergenic
913442248 1:118910085-118910107 GAGGGGAATGAGAGGAAAGATGG - Intronic
913556451 1:119971965-119971987 GAGGGTAATGAGGGAAATGAGGG + Intronic
916272789 1:162961884-162961906 AAGGGTGAGGAGAGGCAAGTAGG - Intergenic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918739559 1:188110745-188110767 AAAGATAAGGAGAGGGATGAAGG + Intergenic
919428308 1:197461439-197461461 GTGGGTTATGAGAGCCATGAAGG + Intronic
919924464 1:202185294-202185316 GAGGGTCATGAGAGGTCTGAGGG + Intergenic
920839861 1:209545269-209545291 AAGGAGAATGTGAGGCCTGAGGG - Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921501491 1:215909639-215909661 AAGGGCATTGAGAGTGATGAGGG + Intronic
921669977 1:217914523-217914545 AGGATTAATGAGAGGCATGAAGG - Intergenic
922112043 1:222569100-222569122 AAGGGAAATGAAAGGCATTCTGG + Intronic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
924196076 1:241608517-241608539 GAGGATAATGTGAGGCATGGTGG + Intronic
924578969 1:245306745-245306767 AAGGCTTATAAGAGGGATGAAGG - Intronic
1063520464 10:6736307-6736329 ATGAGCAGTGAGAGGCATGAAGG + Intergenic
1064778491 10:18806892-18806914 AAGGCTGCTGTGAGGCATGATGG - Intergenic
1065632602 10:27695839-27695861 AAGGGTAATGAGAGCTGTGTGGG + Intronic
1066355603 10:34680583-34680605 AAGGGGAATGAGAAGCGGGAGGG + Intronic
1068894790 10:62187452-62187474 AAAGGAAAGGAGAGGCCTGAGGG - Intronic
1069532592 10:69230221-69230243 AAGGGGCATGGGAAGCATGAGGG + Intronic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070984707 10:80678717-80678739 AAGGGGAAAGAGTGGCAGGAGGG + Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072577944 10:96717522-96717544 AAGAGTATTGAGAGGCCTCAAGG + Intronic
1074496128 10:113981542-113981564 AAGGATTATGAGTGGCATAATGG + Intergenic
1074611245 10:115024244-115024266 AAGGTTAAAGAGAGACAGGAAGG - Intergenic
1077700258 11:4434828-4434850 CAGGGGAATGAGGGGCATGAAGG - Intergenic
1077977659 11:7264698-7264720 CATGATCATGAGAGGCATGATGG + Intronic
1080693832 11:34583740-34583762 AGGGGTAATGAGGAGCATCAGGG - Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1081837319 11:46166609-46166631 AATGGTAATGAGAGGGATCACGG + Intergenic
1083645100 11:64167474-64167496 AAGGCTACAGAGAGCCATGATGG + Intergenic
1085069625 11:73531733-73531755 AAGGGGAATGAAAGGCATTGTGG - Intronic
1086212292 11:84335197-84335219 AAGGGAAAGGAAAGGAATGAAGG + Intronic
1088715397 11:112544379-112544401 AATGGCAATGAGAGGGAGGAAGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089251738 11:117168405-117168427 AAGGGGAAAGGGGGGCATGAAGG - Exonic
1089696223 11:120217958-120217980 AAGGGCAGGGAGAGGCATCAGGG + Intronic
1091085268 11:132715539-132715561 AATGGTATTGGGAGGCATGGGGG + Intronic
1092955172 12:13542915-13542937 AATGGCAATGAGGGGCAAGAAGG - Exonic
1093006870 12:14060777-14060799 AATGGGACTGAGAGGGATGAAGG - Intergenic
1094175100 12:27533229-27533251 AAGGATAATGTGGGTCATGATGG - Intronic
1094220594 12:27988706-27988728 AAGGGTCAGGAAATGCATGAAGG - Intergenic
1094342486 12:29428491-29428513 AAGGGTATTGACAGGAATTAGGG + Intronic
1094398295 12:30032611-30032633 GAAGGGAATGAGAGGTATGAAGG + Intergenic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1096346240 12:50849504-50849526 AAGGGTCATGAGAGGATTTAAGG - Intronic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1098214855 12:68204646-68204668 AAGAGTAATGAGAGTCAAAAAGG + Intronic
1099288978 12:80751428-80751450 AAGGGTAATGAGAGGCTGAGGGG + Intergenic
1099669830 12:85675593-85675615 AAGGGAAATGATAGGGAAGAAGG + Intergenic
1099860519 12:88220035-88220057 AAAGGTAAAGAGAGGCAAGTTGG + Intergenic
1100096737 12:91048536-91048558 AAGGGGAGTGAGAGGAACGAGGG - Intergenic
1106365426 13:29074387-29074409 AAGGGTGCTAAGTGGCATGACGG - Intronic
1106410747 13:29509848-29509870 AAGGGTAATGATACCAATGAGGG - Exonic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1106810278 13:33351949-33351971 AATGGGAATGACAGGGATGATGG + Intergenic
1110449063 13:75620331-75620353 AAGAGAAATGAGGGGAATGAGGG + Intergenic
1111086779 13:83386058-83386080 GAGGTGAATGTGAGGCATGAAGG - Intergenic
1111446885 13:88357791-88357813 AATAGTAATGAGAGGAATGTTGG + Intergenic
1112727469 13:102320869-102320891 AAGGTGAATGGGAGGGATGAAGG - Intronic
1113754832 13:112803973-112803995 GAGGGGAATGAGGGGAATGAGGG - Intronic
1115827226 14:37291774-37291796 AAGGGCAAAAAGAGGCAAGAGGG + Intronic
1116525568 14:45900091-45900113 AAGAGTAAAGAGAGGCTTGCAGG + Intergenic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1120942402 14:89961217-89961239 AAGGTGAAGGAGAGACATGAAGG + Intronic
1121434361 14:93909395-93909417 AAGGATACTGAGAGGCAAGAGGG + Intergenic
1122005072 14:98696721-98696743 AAGCTTAATGAGAGGGGTGATGG - Intergenic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1124248027 15:28087456-28087478 ATAGGTAAGGAGAGGCATGGTGG + Intronic
1124827770 15:33115708-33115730 TAGGGATATGAGAGGCAGGAAGG - Intronic
1125124870 15:36208412-36208434 AGGAGTGATGAGAGGCATGGAGG + Intergenic
1125585149 15:40814441-40814463 ACTGGAAGTGAGAGGCATGATGG + Exonic
1125896976 15:43310638-43310660 AAGGGTAATGGAAGCCATTAGGG + Intergenic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1129766195 15:78170158-78170180 AAGGGAAAGGAGATGCCTGAGGG - Exonic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1133355267 16:5131667-5131689 AAGGGTAATGAGAGCTATTTTGG + Intergenic
1134834965 16:17353648-17353670 ATGGGTAGAGAGATGCATGATGG - Intronic
1137071078 16:35905305-35905327 ATGGGTAATTATATGCATGACGG + Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138303291 16:55950663-55950685 ATTGGAAATAAGAGGCATGAAGG + Intronic
1138854201 16:60668112-60668134 AAGAGTAACAAGAGGCATGTGGG - Intergenic
1138985212 16:62320223-62320245 AAGGGTAGTGAGAGGGTTGGGGG - Intergenic
1139747046 16:69083122-69083144 AAGGCTAAAGTGAGCCATGACGG - Intronic
1143145487 17:4772454-4772476 CAGGATAATAACAGGCATGAGGG + Intronic
1144620056 17:16812750-16812772 AATGGTAATAGGAGGCATGTGGG + Intergenic
1144892633 17:18502954-18502976 AATGGTAATAGGAGGCATGTGGG - Intergenic
1145139581 17:20441333-20441355 AATGGTAATAGGAGGCATGTGGG + Intergenic
1145941900 17:28747064-28747086 AAGGGCAAGCAGAGGCCTGAGGG - Intronic
1146409986 17:32574548-32574570 AATGGTGATGAGCAGCATGAAGG - Intronic
1146903481 17:36602643-36602665 ACAGGTAATGAGGGGCAAGAGGG + Exonic
1148201775 17:45754075-45754097 AAGGGGAAGGAGGGGAATGAGGG - Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1150459238 17:65333401-65333423 CAGGGTGGTGAGAGTCATGAGGG - Intergenic
1150655475 17:67036400-67036422 GAAGGGAAGGAGAGGCATGAGGG - Intergenic
1150859864 17:68790380-68790402 TAGGGTGGGGAGAGGCATGAGGG + Intergenic
1151252510 17:72847466-72847488 AAGGGTCAAGAGGGGAATGAGGG + Intronic
1151447430 17:74176428-74176450 AAGGAGGATGAGAGGCAGGAAGG + Intergenic
1151502442 17:74499985-74500007 GAGAGTGATGAGAGGCAGGAAGG + Intergenic
1152305247 17:79516583-79516605 AGGAGTAATTAGAGGAATGAGGG - Intergenic
1153255339 18:3164504-3164526 AAGGCTAAGGAGAGGAATGGAGG - Intronic
1154205760 18:12335456-12335478 AAGGGGAAAGAGTGGCAGGAAGG - Intronic
1155736895 18:29235458-29235480 AAGGGAAATGTAAGTCATGAGGG + Intergenic
1156950725 18:42893815-42893837 AAGAGTAATGAAAGGAGTGAGGG - Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157466498 18:47951278-47951300 AAGGGGAAGGAGAGGAATTAGGG + Intergenic
1158370121 18:56791859-56791881 AAGGAAAGTGAGAGGCAGGAGGG + Intronic
1160676548 19:394245-394267 AAGGGTGATGGGAAGGATGATGG + Intergenic
1160676733 19:395088-395110 AAGGATGATGGGAGGGATGATGG + Intergenic
1160695323 19:481201-481223 AAGGATGATGAGAAGGATGATGG + Intergenic
1160695424 19:481648-481670 AAGGATAATGGGAAGGATGATGG + Intergenic
1160709628 19:545024-545046 AAAGGAAGAGAGAGGCATGATGG - Intronic
1161814201 19:6489368-6489390 AGGAGTAAGGAGAGGCATGAGGG - Intergenic
1162156466 19:8681423-8681445 AAGGGTAATCAGATGCATGTGGG + Intergenic
1163640364 19:18458535-18458557 AGGGATAATGAGGGTCATGAAGG + Intronic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165971709 19:39637308-39637330 AAGCTTAAAGAGAGGCATGGAGG + Intergenic
1165977709 19:39691789-39691811 AGGCTTAATGAGAGGCATGGGGG + Intergenic
1166347444 19:42175435-42175457 AGGGGAAATGAGTGGCAGGAAGG + Intronic
1166479894 19:43162499-43162521 AAGTGTAATGAGAGGAAAGTAGG - Intronic
1167252698 19:48409113-48409135 AAGGGCAAAGAGAGGAGTGAGGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168553751 19:57321085-57321107 AAGTGTGATGAGATCCATGAAGG - Intronic
1168609565 19:57788218-57788240 AATGGTAATGAGTTGAATGATGG - Intronic
926241535 2:11092686-11092708 AGGGGAAATGGGAGGCAAGAAGG + Intergenic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
927348374 2:22074691-22074713 AAGGGTAATGGGAGGGGTGAAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
930779114 2:55205534-55205556 AGGGATACTGAGGGGCATGAGGG + Intronic
931439844 2:62280948-62280970 AAGTGAAATGAGAGCCTTGATGG - Intergenic
933174348 2:79158947-79158969 AAGGGTAATAAGAGACTGGATGG - Intronic
933326075 2:80839116-80839138 AAGGGTAGTGAGAGGGTTGTTGG - Intergenic
935118396 2:100158378-100158400 AAGGATTAAGAGAGGCATCAGGG - Intergenic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
936804683 2:116315897-116315919 AAGGGAAATAAGAGGAATAAAGG + Intergenic
937266346 2:120617016-120617038 AAAGATACTGAGAGGCCTGAAGG + Intergenic
939490850 2:142874444-142874466 AGGGGAAAGGAGAGGCAGGAGGG + Intergenic
939625021 2:144466343-144466365 AAAGCTAATGAGAATCATGATGG + Intronic
939698074 2:145353460-145353482 TATTGTTATGAGAGGCATGAAGG + Intergenic
939751204 2:146049169-146049191 AAGGGTAGTGAGAAGCTTGGGGG - Intergenic
940426986 2:153541434-153541456 AAGAGAAATGAGAGACAGGAGGG - Intergenic
941940984 2:171037138-171037160 TAGGGTATTAAGAAGCATGATGG + Intronic
942978812 2:182053546-182053568 AAGGGTAATGAGAGCTAGAAAGG - Intronic
944346164 2:198668468-198668490 GAGGGCAATGACAGGCTTGAGGG - Intergenic
944427551 2:199599078-199599100 GAGGGAAATGAGAGACAGGATGG + Intergenic
944439524 2:199727921-199727943 AAGGGAAATGAGAGAGATGATGG - Intergenic
946299810 2:218815785-218815807 ATGGGTATTGAGAGACAGGATGG - Intergenic
946504100 2:220280685-220280707 AAGGGTTATGAGGAGCAGGAAGG - Intergenic
947523018 2:230863100-230863122 AAGCGTAAGGAGAGGCCCGAGGG + Intergenic
1170634756 20:18094394-18094416 AAGACTGATAAGAGGCATGAGGG + Intergenic
1170636855 20:18114162-18114184 AAGGGTAATGGGGGTTATGAGGG - Intergenic
1175030732 20:55951189-55951211 AAGGGTCCTGAGAGGGAAGATGG + Intergenic
1175591359 20:60194428-60194450 AAAGGTAATGAGAGGGAAAATGG - Intergenic
1177313790 21:19430597-19430619 AAGGGTAATAGGAGGAATTATGG - Intergenic
1177518798 21:22190350-22190372 AAGGGTAGTGACAGTCATGGAGG - Intergenic
1177690457 21:24499955-24499977 AAGGGAAGTGGGAGGAATGAAGG - Intergenic
1178177733 21:30123732-30123754 AAGGGTAGTGGGAGGCTGGAGGG - Intergenic
1178225369 21:30710928-30710950 AAGGGAAAGGAGAGGCAAGAAGG + Intergenic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1181164475 22:20976024-20976046 GAGGGTAAGGAGAGGTTTGAGGG + Intronic
1182110889 22:27722527-27722549 AAGGGTAAACAGAGTCATAAGGG + Intergenic
1182957854 22:34443795-34443817 ATGGGTGTTGGGAGGCATGATGG - Intergenic
1183733609 22:39631489-39631511 TGGGGCAATGAGAGGCAGGAGGG + Intronic
1184312148 22:43653082-43653104 AAGAGTGAAGAGAGGCATGTGGG + Intronic
1184699328 22:46159761-46159783 TTGGAAAATGAGAGGCATGAAGG + Intronic
1184763438 22:46558538-46558560 AAGGGTTGTTAGAGGCAGGATGG - Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952993286 3:38852168-38852190 AAGGGCAATGAGAGGAAGGAGGG + Intronic
953095998 3:39777847-39777869 AAGGACAATGAGAGTCTTGAAGG + Intergenic
953753807 3:45630089-45630111 AAGGGAAGTGAGAGGAATAAGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954623814 3:52011306-52011328 AAGGATTATGGGAGGCTTGATGG + Intergenic
955829380 3:62985029-62985051 AAGGGTAAGCAGAGTCCTGAGGG - Intergenic
955929943 3:64046474-64046496 AAGGAAACTGAGAGGCAGGAGGG - Intergenic
956758396 3:72413433-72413455 ATGGGTATTGACAGGCAGGATGG - Intronic
957318268 3:78595552-78595574 ATGGATAATAAGAGGCATTAAGG + Intergenic
959361173 3:105394322-105394344 AAGGGACATGCGAGGGATGAGGG + Intronic
963406544 3:144870740-144870762 AAGGGTCAAAAGAGGCATTAAGG - Intergenic
966771207 3:183505195-183505217 AAGGGTGATGAGTGGATTGATGG - Intronic
967159502 3:186722881-186722903 AAGGAAAAGGAGAGGCAAGAAGG - Intronic
967293335 3:187942956-187942978 AAAAGTAATGTGAGGAATGAGGG - Intergenic
969548031 4:7844757-7844779 GAAAGTAATGAGAGGAATGACGG - Intronic
969572743 4:8019561-8019583 ATGGGTATTGACAGGCATGCGGG + Intronic
971305873 4:25480923-25480945 AATGGTGTTGAGAGGCATGAGGG - Intergenic
971665313 4:29475965-29475987 AAGGGTAATGGGTGGCTGGAGGG + Intergenic
974553329 4:63409272-63409294 AAAGATTATGAGAAGCATGAAGG + Intergenic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
977604865 4:98973806-98973828 AATGGTAGTGAGAGGCTGGATGG - Intergenic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
977999275 4:103537222-103537244 ATGGTTAATGATAGGGATGAGGG - Intergenic
978383437 4:108155289-108155311 AAAGGGAATGAGACGTATGAGGG - Intronic
980172150 4:129302847-129302869 AAGGGTAATGGGTGGGATGGGGG + Intergenic
980687106 4:136242593-136242615 AAGGGTAGTGAGAGGCTGGTGGG + Intergenic
980770176 4:137361792-137361814 AAGGTTGATGACAGACATGAGGG + Intergenic
980846264 4:138329277-138329299 AAGGGAAAGGAAAGGAATGAAGG + Intergenic
983343085 4:166491238-166491260 AAGTGTAATTTGAGGCATGTTGG + Intergenic
983689412 4:170450422-170450444 AAGAGTAATGGGAGGCAGGGTGG - Intergenic
985243345 4:187954577-187954599 AAGTGTAATGAGTTGAATGATGG + Intergenic
987259670 5:16190460-16190482 AAGGGGAAGGAGAGTCAAGAAGG + Intergenic
990277589 5:54214775-54214797 AAGGAAAGTGAGAGACATGAGGG - Intronic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
993209986 5:84936468-84936490 AAGGGTTATGAAAGACATGGAGG + Intergenic
997370791 5:133358374-133358396 AAGGCTGATTAGAGGAATGACGG + Intronic
998490239 5:142540378-142540400 AAGGGTGATGAGATGCAAGTTGG + Intergenic
998670297 5:144345993-144346015 AAGGGTAATGAGGGACTTGGGGG - Intronic
998695814 5:144638050-144638072 AAGGGTAGTGAGTGGCTTGTTGG + Intergenic
998751083 5:145322184-145322206 AAGGGTAAGGAGATGTATTATGG - Intergenic
998968757 5:147568819-147568841 GGCTGTAATGAGAGGCATGAAGG + Intergenic
999222855 5:149995867-149995889 AAGATTAATGAGTGGCATGCAGG - Exonic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1001519866 5:172383756-172383778 AAGGCTCATGAGAGGCACCAGGG - Intronic
1002686777 5:181018166-181018188 AAGGATGATGTGGGGCATGATGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005346713 6:24897684-24897706 TCTGGTAATGAGAGGTATGATGG - Intronic
1007518476 6:42432090-42432112 AAGAGGAATCTGAGGCATGAGGG - Intronic
1008546534 6:52588613-52588635 AGGGGAAGTGAGAGCCATGAGGG - Intergenic
1008612449 6:53196927-53196949 AAGGATCAAGAGAGGCATGTCGG - Intergenic
1008918328 6:56814921-56814943 AAGATAAATGAGAGGCAGGACGG + Intronic
1009668557 6:66714959-66714981 AAGGGTAATGGGAGGCAGTGAGG + Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1011823976 6:91284972-91284994 AAGGGTCAAGAGAAGCCTGAAGG + Intergenic
1014129716 6:117816916-117816938 AAGGGCCAGGAGAGGCAAGAGGG - Intergenic
1015014833 6:128399638-128399660 AAGGGTAATGGGGGCCCTGAAGG - Intronic
1015048731 6:128813002-128813024 AAAGGTGATGATAGGTATGATGG - Intergenic
1015678344 6:135776228-135776250 GAGGGTAATAAGTGCCATGAGGG - Intergenic
1016257220 6:142122011-142122033 ACTGGGAATGAGAGGCATGTGGG - Intergenic
1016499587 6:144704606-144704628 AAGGGTAATGTCAAACATGATGG - Intronic
1016547557 6:145241378-145241400 AATGGAAATGAGAGCCATCATGG + Intergenic
1016562310 6:145410365-145410387 AAGACTAATGAGAGGTTTGAGGG + Intergenic
1016801356 6:148172615-148172637 AACAGTAAAGGGAGGCATGATGG - Intergenic
1018434772 6:163750263-163750285 AAGTGTAATGGGAGCCAAGATGG - Intergenic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019853751 7:3584366-3584388 AAGGGTCATGTGGGGCTTGAAGG - Intronic
1020612937 7:10423423-10423445 AAGGGTAGTGGGAAGCTTGAAGG - Intergenic
1021087462 7:16439334-16439356 AATGGTAATGAGTGCAATGAAGG - Intergenic
1022291768 7:29011508-29011530 AAGGCTAAAGTGAGCCATGATGG + Intronic
1023439885 7:40174322-40174344 AAGGTTACAGAGAGCCATGATGG - Intronic
1024300044 7:47880085-47880107 AAGGGTAAGGCGAGGCCTGTGGG + Intronic
1024663027 7:51517523-51517545 AAGTGTAATGAGATGGATTAAGG + Intergenic
1026031897 7:66801528-66801550 AAGGGTAATGCAGGGCATGGGGG - Intronic
1026697795 7:72611230-72611252 AAGTGTAATCAGAGCTATGATGG - Intronic
1027471182 7:78576423-78576445 AAGGGGAATGACAGACAGGAGGG - Intronic
1028586367 7:92456081-92456103 AAGGTTGATGTGAGGAATGAAGG + Intronic
1029035990 7:97522456-97522478 AAGGGTGATGCCAGGGATGAGGG - Intergenic
1030207882 7:106968229-106968251 GTGGGAAATGAGGGGCATGAAGG + Intergenic
1030987009 7:116253568-116253590 AAGGGACAGGAGAGGCAAGAAGG - Intronic
1031459323 7:122026559-122026581 ATGAGGAATGAGAGACATGAGGG - Intronic
1031620751 7:123931190-123931212 AATGGGACTGAGAGGCAGGAGGG - Intronic
1033193289 7:139303550-139303572 ATGGGTAATCTGAGGCACGAAGG - Exonic
1033312177 7:140269797-140269819 AAGTACAATGAGAGGCCTGAAGG - Intergenic
1033386859 7:140885540-140885562 AATGTTAATAAGAGGTATGAAGG - Intronic
1033617267 7:143028835-143028857 AATGGTAATGTGAGGCAGGAAGG - Intergenic
1034381257 7:150695509-150695531 AAGTCTAATCAGAGGCTTGATGG - Intergenic
1037569569 8:20147189-20147211 AAAGGGAATGAGAGAGATGATGG + Intronic
1037715172 8:21391511-21391533 AATGGGACTGAGAGACATGAAGG - Intergenic
1038834916 8:31108833-31108855 AAGGGAAAGGAGATGCCTGAGGG + Intronic
1039328301 8:36509218-36509240 AATGGGACTGAGAGGCAGGAGGG - Intergenic
1039575772 8:38622928-38622950 AAGGTTTATTAGAGACATGAAGG + Intergenic
1040628792 8:49184415-49184437 AAGGGTAATAAAAGACATGATGG + Intergenic
1041387273 8:57318001-57318023 AAGGGAGAAGAGAGGCAGGAAGG - Intergenic
1042440487 8:68820484-68820506 AAGAGTAATGAGAGCCAAGAGGG - Intergenic
1043243567 8:77968972-77968994 AAGGGTCATAAGAGGCTTTATGG - Intergenic
1044488525 8:92783358-92783380 TAGGTGAAGGAGAGGCATGAGGG + Intergenic
1046227610 8:111305630-111305652 AAGGTTCATGAGGGGCAGGAGGG - Intergenic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1047853933 8:128889483-128889505 AAGGGTAATGAGAGTTATGTTGG + Intergenic
1048720792 8:137322004-137322026 AAGGGAGAAGAGAGGCATTAGGG + Intergenic
1048951768 8:139502370-139502392 AATGGTAAGGAGGGGCTTGAGGG + Intergenic
1048975931 8:139673051-139673073 AAGGAGAACGAGAGGCAAGAAGG + Intronic
1049473155 8:142785179-142785201 AAAGGGAAGGAAAGGCATGAGGG + Exonic
1049720435 8:144113052-144113074 AAGGGCAATGAAGAGCATGATGG - Intronic
1049969410 9:808150-808172 AAGGGGAATGAGAGGTGAGATGG + Intergenic
1051080956 9:13292729-13292751 AAAGGTAAGGCCAGGCATGATGG - Intergenic
1051379354 9:16439564-16439586 AAGCATGATGAGAGGCATAAGGG + Intronic
1053596604 9:39568513-39568535 AAGGGGAATGCAAGTCATGAAGG - Intergenic
1053854570 9:42325153-42325175 AAGGGGAATGCAAGTCATGAAGG - Intergenic
1054569652 9:66796489-66796511 AAGGGGAATGCAAGTCATGAAGG + Intergenic
1055131952 9:72785952-72785974 AAGGGGATTGAGAGGCAGGTAGG - Intronic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056725343 9:89109426-89109448 AAGGGTGCTCAGAGACATGATGG + Intronic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058792734 9:108467470-108467492 AAGGCTGATGATAGTCATGACGG - Intergenic
1061191093 9:129083173-129083195 AAGGGCAGTGGGAGGCCTGAGGG + Intronic
1061203647 9:129150926-129150948 CAGGGAAATGTAAGGCATGAGGG + Intergenic
1061618805 9:131797451-131797473 AAAGCGAATAAGAGGCATGAGGG + Intergenic
1185540095 X:896453-896475 GAGGGTTTTGAGTGGCATGAGGG - Intergenic
1187785138 X:22876234-22876256 AAGAATAATGAGATCCATGAGGG - Intergenic
1188764219 X:34072348-34072370 AATGCAAATGAGAGCCATGAAGG - Intergenic
1189915741 X:45853925-45853947 AAGGGAAATGTGAAGCATAATGG - Intergenic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1190441151 X:50475585-50475607 AAAGGTAATGGGAGCAATGAAGG + Intergenic
1194313000 X:92338015-92338037 AAGGGTAGTGAGAGGGTTGGGGG + Intronic
1194717671 X:97305856-97305878 ATGGGAAATGGGAGGCAAGAAGG + Intronic
1194746161 X:97630657-97630679 AAGGGTTCTTATAGGCATGAAGG - Intergenic
1194805975 X:98328474-98328496 AATGGGACTGAGAGACATGAAGG + Intergenic
1195419122 X:104653883-104653905 AATGGCAATGGGAGGTATGAGGG - Intronic
1196336444 X:114541921-114541943 AAGGGGAATGAGGGAAATGAGGG + Intergenic
1197862043 X:130981135-130981157 AAGGGTAGTGAGAGGGTGGAGGG + Intergenic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1199899906 X:152162844-152162866 AAGGGTGAAGAGAGGCTTCAAGG + Intergenic