ID: 1190108482

View in Genome Browser
Species Human (GRCh38)
Location X:47574669-47574691
Sequence CAGGGTAAGCGAGAGGCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 302}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190108482_1190108495 4 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108495 X:47574696-47574718 GGGGGTCGCTGCTGAGCCGGGGG 0: 1
1: 0
2: 0
3: 19
4: 172
1190108482_1190108497 13 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108497 X:47574705-47574727 TGCTGAGCCGGGGGCCCTGCGGG 0: 1
1: 0
2: 3
3: 33
4: 313
1190108482_1190108496 12 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108496 X:47574704-47574726 CTGCTGAGCCGGGGGCCCTGCGG 0: 1
1: 0
2: 2
3: 46
4: 330
1190108482_1190108493 2 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108493 X:47574694-47574716 GTGGGGGTCGCTGCTGAGCCGGG 0: 1
1: 0
2: 5
3: 18
4: 295
1190108482_1190108500 21 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108500 X:47574713-47574735 CGGGGGCCCTGCGGGCTGCTGGG 0: 1
1: 0
2: 3
3: 30
4: 321
1190108482_1190108499 20 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108499 X:47574712-47574734 CCGGGGGCCCTGCGGGCTGCTGG 0: 1
1: 0
2: 8
3: 69
4: 470
1190108482_1190108494 3 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108494 X:47574695-47574717 TGGGGGTCGCTGCTGAGCCGGGG 0: 1
1: 0
2: 1
3: 14
4: 160
1190108482_1190108504 29 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108504 X:47574721-47574743 CTGCGGGCTGCTGGGAGGTCTGG 0: 1
1: 0
2: 3
3: 48
4: 455
1190108482_1190108492 1 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108492 X:47574693-47574715 GGTGGGGGTCGCTGCTGAGCCGG 0: 1
1: 0
2: 0
3: 26
4: 305
1190108482_1190108501 24 Left 1190108482 X:47574669-47574691 CCGCCAGCCTCTCGCTTACCCTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1190108501 X:47574716-47574738 GGGCCCTGCGGGCTGCTGGGAGG 0: 1
1: 0
2: 4
3: 83
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190108482 Original CRISPR CAGGGTAAGCGAGAGGCTGG CGG (reversed) Exonic
900135680 1:1116041-1116063 CGGGGTGAGTGAGGGGCTGGGGG - Exonic
900300849 1:1976382-1976404 GAGGGGAAGCAAGAGGGTGGAGG - Intronic
900552805 1:3265046-3265068 CTGGGTCAGAGAGAGGCTGGGGG - Intronic
901292293 1:8133414-8133436 CAGGGCAAGAGAGAGGGAGGAGG - Intergenic
901766389 1:11502517-11502539 CAGGGTCAGAGAGAGGTTGTGGG + Intronic
902050711 1:13561790-13561812 CAGGCTAAGGGAGAAGATGGGGG - Intergenic
902923424 1:19680563-19680585 CAGGGAAGGCCAGAGGCAGGTGG - Intergenic
903662142 1:24984752-24984774 CAGGGAAAGGGACAGACTGGGGG - Intergenic
904213067 1:28898406-28898428 CAGGGTATGTGAGTGACTGGAGG - Intronic
904300352 1:29549943-29549965 CTGGGTCAGTCAGAGGCTGGAGG + Intergenic
904349272 1:29894374-29894396 CAGGGTAAGCTGGACTCTGGGGG - Intergenic
904457872 1:30658113-30658135 CTGGGTCAGTCAGAGGCTGGAGG - Intergenic
906827817 1:49000446-49000468 CAAGGTATGCTGGAGGCTGGAGG - Intronic
907332607 1:53681060-53681082 CAGGGTCAGAGAGAGGATGCAGG + Intronic
908035834 1:60051855-60051877 CAGGGTTAGGGAGAGACAGGAGG + Intronic
908277558 1:62491305-62491327 TAGGGTAAGAGAGAAGCTTGAGG - Intronic
912798834 1:112708134-112708156 CGGGGGAAGGGACAGGCTGGAGG - Intronic
913043829 1:115056630-115056652 TAGGAGAGGCGAGAGGCTGGGGG - Intronic
913572365 1:120133485-120133507 CAGGATATGCTAGAGGCTGAGGG + Intergenic
914944742 1:152053820-152053842 CAGGGTAGGGGGAAGGCTGGCGG - Intergenic
915164269 1:153939885-153939907 CAAGGTCTGCCAGAGGCTGGAGG - Intronic
915934543 1:160082966-160082988 CATGGGAAGTAAGAGGCTGGGGG + Intronic
917536730 1:175879612-175879634 CGGGGGAACCCAGAGGCTGGTGG - Intergenic
917749498 1:178041231-178041253 CAGGCTAAGGGAGAAGATGGGGG - Intergenic
918444360 1:184602121-184602143 CAGGGTGAGGGTGAGGATGGTGG - Intronic
920218077 1:204375599-204375621 GAGGCTGAGCGAGAGGCAGGAGG - Intronic
921940526 1:220834150-220834172 CATGGTAAGGGTGAGACTGGGGG + Intergenic
922930448 1:229385212-229385234 CAGGGTGAGGGTGAGGGTGGGGG - Intergenic
923624242 1:235601183-235601205 TAGGGTATGGGATAGGCTGGTGG + Intronic
1064093694 10:12407142-12407164 CAGGGCATGAGAGAGGCTGGAGG - Intronic
1064340112 10:14477943-14477965 CAGGGGAAGGGAGGGGATGGAGG + Intergenic
1065483749 10:26217428-26217450 GAAGGCAAGCGGGAGGCTGGCGG - Intronic
1066178692 10:32938795-32938817 CAGGGAAAGGGAAAGGCTAGAGG + Intronic
1067046519 10:42988377-42988399 CAGGGTCACCCAGATGCTGGGGG + Intergenic
1067322883 10:45239114-45239136 CAGGGTAGGAGCCAGGCTGGGGG - Intergenic
1067564106 10:47324534-47324556 CAGGGTAAGTGAGAGGATTAAGG + Intronic
1069768231 10:70879648-70879670 CAGAGGAAGCGAGTGGCTCGGGG - Exonic
1069892802 10:71662443-71662465 CAGGGCAAGGGAGAGGAGGGAGG + Intronic
1070006587 10:72430477-72430499 CAGGGTAAGTGGGAGGCTCGTGG - Intronic
1071713401 10:88071877-88071899 CAGGTGAAGCCAAAGGCTGGGGG - Intergenic
1073315725 10:102579408-102579430 CAGGGGAGGTGGGAGGCTGGCGG - Intronic
1073453367 10:103622410-103622432 CAGTGTTAGCGAGAGACAGGCGG + Intronic
1074680610 10:115903396-115903418 CAGGGGGAGGGAGAGACTGGAGG - Intronic
1076889787 10:133277766-133277788 CAGGGCCAGCAAGGGGCTGGAGG + Intergenic
1077109601 11:856269-856291 CAGGGTGAGCGAGTGTCTGATGG + Intronic
1077266109 11:1651205-1651227 CTGGGTAATGTAGAGGCTGGAGG + Intergenic
1077459653 11:2702632-2702654 CAGGGTTAGGTAGAGGGTGGAGG - Intronic
1077469034 11:2748280-2748302 CAGGGTGAGCTAGGGGGTGGGGG - Intronic
1077916551 11:6615394-6615416 CAGGGTAAGAGTGAGGATGGGGG - Intronic
1078469211 11:11573596-11573618 CTGGATCAGCAAGAGGCTGGTGG + Intronic
1078707540 11:13759583-13759605 TAGGATAAGGGAGAGACTGGAGG - Intergenic
1080797222 11:35575973-35575995 CAGGGAAATTGAGAGGCTGCTGG - Intergenic
1081632535 11:44699622-44699644 CAGGGTCTGTGAGAGGCAGGGGG + Intergenic
1081746231 11:45474276-45474298 CTGGGTAGGCAGGAGGCTGGTGG - Intergenic
1083743043 11:64721285-64721307 CTGGGTGCGCGAGTGGCTGGTGG - Intronic
1084412918 11:69014381-69014403 GAGGCTGAGAGAGAGGCTGGAGG + Intergenic
1084623935 11:70293803-70293825 CAGGGTAAAGCAGAGGCTGAGGG - Intronic
1084938196 11:72598473-72598495 CGGGATGAGCCAGAGGCTGGGGG - Intronic
1085531618 11:77195239-77195261 CAGGGAGAGGCAGAGGCTGGCGG - Intronic
1088706540 11:112469026-112469048 CAGGGTTACAGAGAGGCTAGGGG - Intergenic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1089658617 11:119970966-119970988 GAGAGGGAGCGAGAGGCTGGGGG + Intergenic
1090206088 11:124885183-124885205 CAGGGGCAGGGAGAGGTTGGGGG + Exonic
1090372200 11:126264172-126264194 CAAGGTAAACGTGAGACTGGAGG - Exonic
1090866132 11:130702309-130702331 CAGGGTAGGGAAAAGGCTGGGGG + Intronic
1091797144 12:3303941-3303963 CAGGGGGAGGCAGAGGCTGGAGG + Intergenic
1091937661 12:4446080-4446102 CAGGGAAAGAGAGAGGCGAGAGG + Intergenic
1092262743 12:6961222-6961244 CAGGGTCAGGGAGAGGTGGGGGG - Exonic
1092345773 12:7713352-7713374 CAAGGAAAGGGAGAGACTGGGGG - Intronic
1092508130 12:9124981-9125003 CAGAGCAAGAGAGAGGATGGAGG + Intergenic
1096527526 12:52220319-52220341 CAGGGTAGGGGAGAGCCTGCAGG + Intergenic
1096595393 12:52691900-52691922 CAGGGGCAGAGAGAGGCTGGTGG - Intronic
1097476474 12:60063040-60063062 CATGCTAAGTGAAAGGCTGGTGG + Intergenic
1097734600 12:63167966-63167988 CAGGGTAGAAGAGAGGCTGAGGG - Intergenic
1102228869 12:111248573-111248595 CAGGGTGGGGGAGGGGCTGGTGG + Intronic
1102830246 12:115991615-115991637 CAGGGTAACATAGAGGCTGTGGG + Exonic
1103325241 12:120116271-120116293 CAAGGTCAGCGCGAGGCAGGTGG + Intronic
1104459079 12:128939733-128939755 GAGGAAAAGCGCGAGGCTGGAGG + Intronic
1105954058 13:25263331-25263353 CAAGGTAAGGGAGAATCTGGTGG - Intronic
1106484953 13:30163764-30163786 CAGGCTAAGGTTGAGGCTGGAGG + Intergenic
1110650658 13:77938127-77938149 CAGGCTAAGGGAGAAGCAGGAGG + Intergenic
1112435890 13:99390884-99390906 CAGGGGAAGGCAGAGGATGGCGG - Intergenic
1114608620 14:24019716-24019738 CAGGGTCTGTTAGAGGCTGGGGG + Intergenic
1120251536 14:82065526-82065548 CAGGGTAAGGGAGAAGAAGGGGG + Intergenic
1121239259 14:92416243-92416265 CAGAGTGAGGGAGAGGCTGGTGG + Intronic
1121838669 14:97114920-97114942 CAGGGCTTGCGAGAGGCTGGGGG + Intergenic
1122374032 14:101246914-101246936 CAGGCTGAGCGAAAAGCTGGGGG - Intergenic
1122405561 14:101498776-101498798 TAGGGAAAGAGAGAGGCGGGGGG - Intergenic
1122830902 14:104395224-104395246 CAGGGTCAGGGAGAGGGTAGGGG + Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1202852409 14_GL000225v1_random:30011-30033 CAAGGGCAGAGAGAGGCTGGAGG - Intergenic
1124173314 15:27397657-27397679 CAGCAGAAGCGGGAGGCTGGAGG - Intronic
1124369955 15:29098941-29098963 CAGGGTATGTGAGGGCCTGGAGG - Intronic
1125483882 15:40099022-40099044 CAGGGGAAGAATGAGGCTGGGGG - Intronic
1125957287 15:43799291-43799313 CAGGGTAAGTGAGAGGGGGTCGG - Exonic
1127103249 15:55588247-55588269 CAGGGGAAGCAGGAGGCTCGCGG + Intronic
1129333948 15:74841554-74841576 CCGGGGAGGCGAGAGGCAGGCGG - Intronic
1129670573 15:77605696-77605718 CAGGGTCATCCAGAGGCAGGAGG - Intergenic
1130253600 15:82315797-82315819 TAGGGTATGACAGAGGCTGGAGG + Intergenic
1130957727 15:88639175-88639197 CAGGGTAAGGCAGGGGATGGGGG + Intronic
1131151437 15:90049733-90049755 CAGGGTAGAGGAGAGGCGGGAGG - Intronic
1132519451 16:380795-380817 CAGGGGAGGGGAGGGGCTGGGGG + Intronic
1132710315 16:1263443-1263465 GAGGGGATGCGAGGGGCTGGGGG - Intergenic
1132949740 16:2554503-2554525 AAGGGGGAGCGTGAGGCTGGGGG - Intronic
1132964608 16:2645664-2645686 AAGGGGGAGCGTGAGGCTGGGGG + Intergenic
1133412802 16:5582214-5582236 CTGGGGTAGCGACAGGCTGGTGG + Intergenic
1133475436 16:6116840-6116862 CAGAGGGAGAGAGAGGCTGGTGG + Intronic
1133493416 16:6293886-6293908 CAGGGTGAGCGGGGGGGTGGTGG + Intronic
1134053305 16:11152786-11152808 CAGTGTCAGAGGGAGGCTGGAGG - Intronic
1134629934 16:15749353-15749375 CAGGCTAAGCAAGAGTGTGGAGG - Intronic
1135415623 16:22266349-22266371 CCAGGGAAGCGAGGGGCTGGGGG - Intronic
1135999941 16:27284760-27284782 CAGGGGAAGAAAGAGGCTGGGGG + Intronic
1136005947 16:27329134-27329156 CAGGGCAAGAGAGAGGAGGGAGG - Intronic
1136356037 16:29745382-29745404 AAGGGTAAGCGTGAGCCAGGTGG + Intronic
1136484948 16:30565693-30565715 CATGGGAAGCGAGAGCCTTGTGG + Intergenic
1137436113 16:48455516-48455538 CAGGGAAAACGATGGGCTGGAGG + Intergenic
1137493136 16:48949815-48949837 GAGGGCAGGGGAGAGGCTGGGGG - Intergenic
1137735593 16:50720637-50720659 CAGGATAGGAGAGAGGCTGCTGG - Intronic
1138071998 16:54001907-54001929 CAGTTTGAACGAGAGGCTGGTGG - Intronic
1138247934 16:55480696-55480718 CAGGTTGAGGGGGAGGCTGGAGG - Intronic
1138542128 16:57694897-57694919 CAGGGAAAGGGTGAGGCTGGTGG + Intronic
1140020643 16:71235196-71235218 CTGGGTAAGTCAGAGGCTTGGGG - Intergenic
1140743777 16:77963641-77963663 CAGTGTCACCGAGAGGCTGGGGG + Intronic
1141377061 16:83541124-83541146 TAGTGTAGGCCAGAGGCTGGAGG - Intronic
1141838642 16:86559894-86559916 CAAGGTAAGCGGATGGCTGGGGG + Intergenic
1142016077 16:87748405-87748427 CACAGGCAGCGAGAGGCTGGTGG + Intronic
1142360168 16:89622263-89622285 CAGGGGAGGGGAGAGGCAGGAGG + Intronic
1142378029 16:89716963-89716985 CAGGGTCAGTGAGGGGATGGGGG - Intronic
1142439532 16:90086754-90086776 CATGGTAAGTGTGAGGGTGGGGG - Intronic
1143024033 17:3930467-3930489 CAGGTCAGGCGAGGGGCTGGTGG + Intronic
1143634950 17:8159281-8159303 AAGGGTAGGAGAGATGCTGGAGG - Exonic
1145819076 17:27817416-27817438 CAGGGTAGGAGAGAGGCGGAGGG + Intronic
1147154894 17:38539490-38539512 CAGGGTGAGAGAGAGGTAGGTGG + Intronic
1147157583 17:38552000-38552022 CAGGTTCAGCGGGGGGCTGGGGG + Exonic
1147186105 17:38713805-38713827 CAAGGGAAGAGAGGGGCTGGGGG - Intronic
1147419189 17:40313659-40313681 CAGGGTAGGGGAGAGGGTGTTGG - Intronic
1147746744 17:42699350-42699372 CAGGGCAGGGGGGAGGCTGGGGG - Exonic
1149003513 17:51780790-51780812 CAGTGTGAGCAAGAGCCTGGAGG + Intronic
1150561581 17:66300036-66300058 CAGGGGGACCCAGAGGCTGGAGG - Intergenic
1150641733 17:66953972-66953994 GAGAGTGAGAGAGAGGCTGGTGG - Intergenic
1151893717 17:76966429-76966451 TGGGGTAAGCCAGAGGCTGAGGG + Intergenic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152326784 17:79646106-79646128 CTGGGGAAGGGAGTGGCTGGGGG - Intergenic
1152664097 17:81557413-81557435 CAGAGTAAGGGAAATGCTGGTGG + Exonic
1152879647 17:82807859-82807881 CAGGGCCAGCCAGAGGCAGGAGG - Intronic
1153227733 18:2910735-2910757 CAGGGCAAACGTGAGGCTGGGGG - Intronic
1156924196 18:42556942-42556964 CAGGCTAAGGGAGAAGATGGAGG + Intergenic
1158644536 18:59232803-59232825 CAGGGAAAGCAGGAGCCTGGTGG + Intergenic
1160001408 18:75027730-75027752 CAAGGTCAGACAGAGGCTGGTGG + Intronic
1160152555 18:76406168-76406190 CAGGGTAAAAGAGAGGTTTGGGG - Intronic
1161429992 19:4225995-4226017 AAGGGGCAGGGAGAGGCTGGGGG - Intergenic
1161458284 19:4381051-4381073 CAGGGGGACAGAGAGGCTGGGGG - Intronic
1161458306 19:4381131-4381153 CAGGGGAACAGAGAGGCAGGGGG - Intronic
1161646164 19:5454778-5454800 CAGGGTCAGGGTGGGGCTGGTGG - Intergenic
1161711067 19:5848330-5848352 CAGGCTAAGGGAGAGGAAGGAGG - Intronic
1162028509 19:7907476-7907498 GAGAGAGAGCGAGAGGCTGGAGG - Intronic
1163418640 19:17202041-17202063 CAGGGTATGGGAAAGGCTGAAGG - Intronic
1164513697 19:28917042-28917064 CAGTGAAAGAGAGAGGCTGGCGG + Intergenic
1165115662 19:33527012-33527034 CACGGGAAGGAAGAGGCTGGAGG - Intergenic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1165832577 19:38736805-38736827 TAGGGACAGAGAGAGGCTGGGGG - Intronic
1166139916 19:40800119-40800141 CAGTGATAGGGAGAGGCTGGAGG - Exonic
1167521756 19:49959631-49959653 CAGGGAAAGAGAGAGGGTGGGGG + Intronic
1167523627 19:49971091-49971113 CAGGGAAAGAGAGAGGGTGGGGG - Intergenic
1167557186 19:50203723-50203745 CAGGGGAAGCTGGAGCCTGGGGG + Intronic
1167716573 19:51146122-51146144 GTGGGTAAGGGAGGGGCTGGAGG + Intronic
1167761976 19:51455395-51455417 GTGGGTAAGGGAGGGGCTGGAGG - Intronic
1168136448 19:54355431-54355453 CAGGGTGAGGGAGTGCCTGGTGG + Intronic
1168275623 19:55276737-55276759 AAAGGTAAGCTAGAGGGTGGCGG + Intronic
1168282126 19:55311515-55311537 CAGGGTAGGAGAGAGTCGGGGGG + Intronic
1168348802 19:55664007-55664029 CTGGGGAAGCGAGGGGCTTGTGG + Intronic
1168720007 19:58549647-58549669 CAGGGTGAGTGTGAGGCTGGTGG + Exonic
925024943 2:600317-600339 CAAGGTAAGAGAGGGACTGGCGG - Intergenic
928928417 2:36600320-36600342 CAGGCTAAGCGAGAAGGAGGAGG - Intronic
929664229 2:43821497-43821519 CTGGGGAAGTGAGAGGCAGGAGG - Intronic
931071139 2:58651824-58651846 CAGGGAAAGCCAGTGTCTGGTGG + Intergenic
931790189 2:65658042-65658064 CAGGGTCAGGCAGGGGCTGGAGG + Intergenic
932137999 2:69247508-69247530 CAGGGTTGGGGAGAGGCTGGGGG - Exonic
932266184 2:70368758-70368780 CAGGGGAAGTGAGAGGCAGTTGG + Intergenic
933254832 2:80069071-80069093 CAGGGGAAGCCTAAGGCTGGGGG + Intronic
934056224 2:88253451-88253473 CAGGGTCAGTGAGAGCTTGGGGG + Intergenic
934553541 2:95276172-95276194 CTGGGTAAGAGGGAGCCTGGGGG - Intronic
934558135 2:95298155-95298177 GAGAGTCAGCTAGAGGCTGGAGG - Intronic
934980291 2:98833851-98833873 CAGGGTAGGGGAGTGGCAGGAGG - Intronic
935637611 2:105261775-105261797 CAAGGCAAGGCAGAGGCTGGAGG + Intergenic
937009827 2:118552449-118552471 ATGGGGAAGGGAGAGGCTGGTGG - Intergenic
938478357 2:131635992-131636014 AAGGGTGTGCGAGAAGCTGGTGG - Intergenic
940726578 2:157342570-157342592 CAGGGTAAGGGAGAAGAAGGAGG + Intergenic
941290152 2:163664090-163664112 TATGGTAAGGGATAGGCTGGAGG + Intronic
942359318 2:175155364-175155386 CAGGGAAAGCCAGAAGCTTGAGG - Intronic
942514410 2:176737098-176737120 CAAGGGAAGCTTGAGGCTGGTGG + Intergenic
943091143 2:183376284-183376306 CAGAGGAAGAGAGAGACTGGAGG - Intergenic
944871692 2:203918516-203918538 AAGCGGAAGCCAGAGGCTGGGGG + Intergenic
945276939 2:207997619-207997641 AAGGGTTAATGAGAGGCTGGGGG - Intronic
946239191 2:218343614-218343636 CAGGCTGAGCGTGGGGCTGGAGG - Intronic
946279475 2:218656327-218656349 CACGGTTAGAGAGAGGCGGGGGG + Exonic
946428083 2:219610287-219610309 CAGGGTCCGGGAGGGGCTGGGGG - Intronic
947148731 2:227092387-227092409 CAGAGAAAGAGAGAGGATGGAGG + Intronic
948923099 2:241075639-241075661 AAGGACAAGCCAGAGGCTGGAGG - Intronic
1168805976 20:672621-672643 CAGGGTCAGGATGAGGCTGGCGG - Intronic
1169291170 20:4354306-4354328 AAGGGTAATCGAGAGGGTGCTGG - Intergenic
1171171403 20:23018423-23018445 CAGGGGAAGGGAGAAGTTGGAGG + Intergenic
1172856154 20:38004294-38004316 CAGGGTTGGCATGAGGCTGGGGG - Intronic
1173252913 20:41374076-41374098 CAGGGATGGGGAGAGGCTGGGGG + Intergenic
1174577356 20:51545984-51546006 CAGGGTAAGCCTCAGGGTGGAGG - Intronic
1175220654 20:57414638-57414660 CAGGGTAAGCGAAGCGATGGAGG + Intergenic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175750727 20:61495400-61495422 CAGGATAAGCGGGGGGCTGGCGG - Intronic
1176075344 20:63245692-63245714 GAGGGTCTGGGAGAGGCTGGCGG - Intronic
1176915565 21:14621574-14621596 CAAGGTCACAGAGAGGCTGGGGG + Intronic
1179210780 21:39322754-39322776 CAGTCTGAGAGAGAGGCTGGGGG - Intergenic
1179630470 21:42674704-42674726 GGGGGTAGGAGAGAGGCTGGTGG - Intronic
1183241143 22:36659183-36659205 AAGGGAAAGCGGGAGGGTGGGGG + Intronic
1184222503 22:43110077-43110099 CCGGGTCCGCGAGAGGCGGGCGG - Intergenic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
949888014 3:8711701-8711723 CAAGGTAAGCCTAAGGCTGGTGG + Intronic
950465125 3:13149046-13149068 AAGGGGAGGCGAGGGGCTGGTGG - Intergenic
951648924 3:24926601-24926623 GAGGCTAATCGAGAAGCTGGGGG + Intergenic
951994823 3:28715233-28715255 CTGGGCAAGAGAGAGACTGGAGG + Intergenic
956146692 3:66198036-66198058 CAGGGTCAGCGTCAGGCTGACGG + Intronic
956750826 3:72342572-72342594 CAAGGGAAGCAAGAGGTTGGAGG - Intergenic
958957853 3:100480506-100480528 CAGGAAAAGCAAGAGGTTGGGGG - Intergenic
959840558 3:110969539-110969561 CGGGGAAAGAGAGAGGCTTGTGG - Intergenic
961567546 3:127774351-127774373 CAGGGGAGGCAAGAGGCAGGAGG - Intronic
961665067 3:128489413-128489435 CAGGTAAAGCGCGGGGCTGGGGG + Intronic
962352034 3:134663444-134663466 AAGGATAAGGCAGAGGCTGGGGG + Intronic
963456809 3:145555606-145555628 CAGGCTAAGGGAGAAGATGGAGG + Intergenic
966422304 3:179745576-179745598 CTTGGTAAGAGAGGGGCTGGGGG - Intronic
966818564 3:183908120-183908142 CAGGGTAAGTAGCAGGCTGGCGG - Intergenic
968515761 4:1015041-1015063 CTGGGCAAGCCAGGGGCTGGAGG - Intronic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969461407 4:7331098-7331120 TAGGGGCGGCGAGAGGCTGGGGG + Intronic
969493501 4:7512961-7512983 CAGGGGAAAGGAGAGGCTGTAGG + Intronic
969520658 4:7676005-7676027 CAGGGTCAGAGCCAGGCTGGGGG - Intronic
970733174 4:19133103-19133125 AAGGGCAGGTGAGAGGCTGGTGG - Intergenic
972697285 4:41459860-41459882 CAGGGAAAGCTAGAGCATGGAGG + Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974903635 4:68031878-68031900 CAGGCTAAGGGAGAGGATGGAGG - Intergenic
979486086 4:121271929-121271951 CAGGGTAGGGGACAGGCTGGAGG - Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
982318656 4:154057527-154057549 CAGGCTAAGGGAGAAGATGGAGG - Intergenic
984944083 4:184957656-184957678 CAGAGTGAGAGAGAAGCTGGAGG + Intergenic
985828877 5:2213325-2213347 CAGGGTAAGGGAGGGGCTCCAGG + Intergenic
985965736 5:3337909-3337931 CAGGGAAGGTGAGTGGCTGGGGG + Intergenic
986566346 5:9118950-9118972 GAGAGTAAGCGTGAGGCTGGCGG + Intronic
988690233 5:33564572-33564594 TAGGAGAAGGGAGAGGCTGGAGG + Intronic
989600040 5:43192408-43192430 GAAGGTAAGCGAGGGGCTGGGGG + Intronic
990673571 5:58159728-58159750 CAGGGTCAGCGAGACTCTAGTGG - Intergenic
991538596 5:67701287-67701309 CAGGGTCTGTGAGAGACTGGGGG + Intergenic
994670335 5:102755389-102755411 CAGGGCAAGGGTGAGGGTGGGGG + Intronic
995769236 5:115651774-115651796 CAGGCTAAGGGAGAAGATGGGGG - Intergenic
997406780 5:133655295-133655317 CTGGGATAGCTAGAGGCTGGTGG - Intergenic
997802801 5:136883643-136883665 CATGGAAAGTGGGAGGCTGGGGG + Intergenic
998399022 5:141838320-141838342 CAGGGGAGGCCAGAGGCTGAGGG + Intergenic
999370504 5:151052314-151052336 CAGGCTGAGCTAGAGGATGGTGG + Intronic
999425671 5:151485966-151485988 CAGGGTAAGTGTGAGGCAGGAGG + Intronic
999510866 5:152250475-152250497 CAGGGTAAGCGGGTGGTGGGAGG - Intergenic
1001097644 5:168788149-168788171 CAAGGGAAGAGAGAGGGTGGGGG + Intronic
1001120491 5:168976006-168976028 CAGGGTAAGGGTGAAGTTGGTGG - Intronic
1001980798 5:176035905-176035927 CAGGGGTAGGGAGGGGCTGGTGG - Intergenic
1002188499 5:177467120-177467142 CTGGGTTAGGGAGGGGCTGGAGG - Intronic
1003841615 6:10126453-10126475 CTAGGTAACTGAGAGGCTGGTGG - Intronic
1004395861 6:15245861-15245883 CAGGCTAAGCGGGCGCCTGGCGG + Intergenic
1006852709 6:37110732-37110754 ACGGGTAAGCGAGAGGTGGGGGG - Intergenic
1007312122 6:40955022-40955044 CAGGGTCAGGGTGAGGCTGGTGG - Intergenic
1007373891 6:41443501-41443523 GAGGGGAAGCGGGAGGGTGGGGG + Intergenic
1008417650 6:51261578-51261600 CAGGGCAAGAGAAAGGGTGGAGG + Intergenic
1009865774 6:69395912-69395934 CAGGGCAAGCCAGCAGCTGGAGG - Intergenic
1013235515 6:108194971-108194993 CAGGGTCTGTGGGAGGCTGGAGG + Intergenic
1013305254 6:108841737-108841759 CAGGGTTAGGGAGAGGCTGGAGG - Intergenic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1015423829 6:133041270-133041292 CAGGGTAGGCCAGGGGGTGGGGG - Intergenic
1016982075 6:149863389-149863411 CAGGGTAAGCGCGCGACTGAGGG - Exonic
1019086034 6:169478098-169478120 CAGGGTCAGCCAGTGACTGGGGG + Intronic
1019115221 6:169755299-169755321 CTGGGGAAGCGTGAGGCTGCTGG + Exonic
1019149294 6:169993640-169993662 CAGGGTGAGGGAGTGGCTGTGGG - Intergenic
1019172362 6:170139835-170139857 CAGGGTTAGCAAGAGGCTCGCGG - Intergenic
1019485282 7:1286329-1286351 CAGGCTCAGCGAGGGGCTGAGGG + Intergenic
1019898245 7:3999679-3999701 CAGGAGAAGCTGGAGGCTGGAGG + Intronic
1020766460 7:12328104-12328126 CAGGGAAGGCGAGAGGCTGAAGG + Intergenic
1020794057 7:12660835-12660857 CAGGCTAAGGGAGAAGATGGGGG - Intergenic
1022904152 7:34839799-34839821 CAGGGGAAGAGAGAGAGTGGAGG + Intronic
1023205732 7:37747554-37747576 AAGGGCAAGAGAGAGGCTGTAGG + Intronic
1026427987 7:70315714-70315736 GAGGGTAAGAGAGAGGGAGGAGG - Intronic
1026964088 7:74428246-74428268 CAGAGTCAGGGTGAGGCTGGGGG - Intergenic
1029324185 7:99791858-99791880 CAAGGGCACCGAGAGGCTGGAGG + Intergenic
1029547453 7:101217686-101217708 CGGGGAGAGCGAGAGGCTGGCGG + Exonic
1032074296 7:128829342-128829364 CAGGGCAAGCCAAAGGCTGCAGG - Intergenic
1034128989 7:148698791-148698813 CAGGGAAGGCGAGAGGGCGGAGG + Intronic
1034588753 7:152120484-152120506 GAGGGTCAGCCAGAGGCTGTCGG + Intronic
1035756080 8:2034085-2034107 CAGGCTCAGTGTGAGGCTGGTGG - Intergenic
1036213852 8:6863424-6863446 CAGGGAGTGGGAGAGGCTGGAGG + Intergenic
1036227043 8:6968234-6968256 CAGGCTCAGGGAGAGGCTTGAGG - Intergenic
1036229486 8:6987404-6987426 CAGACTCAGCGAGAGGCTTGAGG - Intergenic
1036231937 8:7006507-7006529 CAGACTCAGCGAGAGGCTTGAGG - Intronic
1036640439 8:10580104-10580126 CAGGGAAAGGGGGAGGCAGGTGG + Intergenic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1038035816 8:23685693-23685715 CAGTGTAAGTGAGAGTGTGGAGG + Intergenic
1038403650 8:27305669-27305691 CTGGGACAGGGAGAGGCTGGTGG + Intronic
1038491482 8:27975097-27975119 CAGGAAAAGAGAGAGGCTGAAGG + Intronic
1039793171 8:40891530-40891552 CAGGGAACGCCAGGGGCTGGTGG - Intronic
1049051646 8:140201800-140201822 CAGGGACTGGGAGAGGCTGGGGG + Intronic
1049285657 8:141773788-141773810 CAGGGTCAGAGAGAGGCAGTGGG - Intergenic
1049439195 8:142601485-142601507 CAGATGAAGCGAGAGGCTTGTGG - Intergenic
1049544199 8:143221873-143221895 CAGGGTTGGGGAGAGGCCGGGGG - Intergenic
1049938534 9:522798-522820 CAGGGTAGGTCAGAGGCTGGTGG - Intronic
1050424327 9:5498535-5498557 CATGGTCAGCCAGGGGCTGGAGG - Intergenic
1050672302 9:8011169-8011191 CAGAGAAAGCGAGAGACTGGGGG + Intergenic
1051166408 9:14266720-14266742 GAGGGTAAGGGAGAGGGAGGAGG - Intronic
1053434400 9:38065957-38065979 AAGGGCAAGGGAGAGGTTGGGGG - Intronic
1054775455 9:69120851-69120873 CCGGCTAAGGGTGAGGCTGGCGG + Intergenic
1054915901 9:70494980-70495002 CAGGGAAAGCGAGAAAGTGGTGG - Intergenic
1056225726 9:84493362-84493384 CAGGGTAAGACAGAGGCCAGAGG + Intergenic
1057828180 9:98387072-98387094 CAGGGGAGGGGAGAGCCTGGGGG + Intronic
1059026634 9:110641081-110641103 CAGGGTAAGTGAGTGGGTTGGGG - Intergenic
1059387795 9:113978416-113978438 CAGGGAGAGAGAGAGGCAGGTGG + Intronic
1060156568 9:121324489-121324511 CAGGGCAAGGGAGAGGCTCAGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061449036 9:130658946-130658968 GAGGGTGAGCTGGAGGCTGGAGG + Intergenic
1061450394 9:130664340-130664362 CAGGGTGGGTGAGAGGCGGGTGG - Intergenic
1061951268 9:133937587-133937609 CTGGGTAATGGAGAGGCTGATGG - Intronic
1062168782 9:135122661-135122683 CAGGGCAGGCGAGAGGCTTGGGG - Intergenic
1062354154 9:136154023-136154045 CAGGGGATGGGAGAGACTGGAGG - Intergenic
1203758249 Un_GL000218v1:156100-156122 CAAGGTAACAGTGAGGCTGGGGG - Intergenic
1190108482 X:47574669-47574691 CAGGGTAAGCGAGAGGCTGGCGG - Exonic
1190338382 X:49277141-49277163 CAGAGTAAGCGAGCGGGTGAGGG - Intronic
1192640367 X:72856706-72856728 GAGGGAGAGCCAGAGGCTGGGGG + Intergenic
1192641344 X:72864070-72864092 GAGGGAGAGCCAGAGGCTGGGGG - Intergenic
1193130368 X:77913402-77913424 CGGGGCAAGGGGGAGGCTGGGGG + Intronic
1195157767 X:102141177-102141199 GAGGGAAAGCGAAAGGCTGAGGG - Exonic
1195275126 X:103274391-103274413 GAGGGAAAGCGAGAGGATGAGGG - Exonic
1200041988 X:153377566-153377588 AAGGGTCAGTGAGGGGCTGGAGG + Intergenic
1200835406 Y:7726982-7727004 AAGATTAAGAGAGAGGCTGGGGG + Intergenic
1201178415 Y:11323278-11323300 CAGAGGAAGCGAGCAGCTGGAGG - Intergenic