ID: 1190110819

View in Genome Browser
Species Human (GRCh38)
Location X:47587898-47587920
Sequence TATCTCCTTTGGTAAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190110811_1190110819 11 Left 1190110811 X:47587864-47587886 CCTGACCTGAACGTGCTTGAAAA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG 0: 1
1: 0
2: 3
3: 36
4: 441
1190110809_1190110819 21 Left 1190110809 X:47587854-47587876 CCTGTGTCCTCCTGACCTGAACG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG 0: 1
1: 0
2: 3
3: 36
4: 441
1190110810_1190110819 14 Left 1190110810 X:47587861-47587883 CCTCCTGACCTGAACGTGCTTGA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG 0: 1
1: 0
2: 3
3: 36
4: 441
1190110814_1190110819 6 Left 1190110814 X:47587869-47587891 CCTGAACGTGCTTGAAAAGGGCC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG 0: 1
1: 0
2: 3
3: 36
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190110819 Original CRISPR TATCTCCTTTGGTAAAGAAA AGG Intronic
900267618 1:1766775-1766797 TTTTTCCTTTGGTAGAGACAGGG + Intronic
901362819 1:8718129-8718151 ATTCTGCTTTAGTAAAGAAATGG - Intronic
901822820 1:11841153-11841175 TTTCTACTTTGGAAAAAAAATGG - Exonic
903916372 1:26767508-26767530 TATCCCCATTTGTAAAGATAAGG - Intronic
905100425 1:35516458-35516480 TATCTCAATAGGTACAGAAAAGG + Intronic
905539072 1:38745845-38745867 GATTTGCTTTGGAAAAGAAAAGG - Intergenic
906123109 1:43408197-43408219 TTTCTCTTTGGGTAAAGAGATGG - Intronic
906183209 1:43839226-43839248 TAGCTCCTTGTGTAAAGCAAGGG + Intronic
906708391 1:47911461-47911483 TTTCTCCTTAGATAAAGAACAGG + Intronic
906939372 1:50242727-50242749 TATCTCATTAGGTGCAGAAAAGG - Intergenic
908924115 1:69232562-69232584 TGTCTCCTGTGGTAAAGCAAAGG - Intergenic
911693964 1:100866653-100866675 TAATTGCTTTGGTAGAGAAATGG - Intergenic
911930528 1:103897176-103897198 TATATTCTTTAGTAAAGAATGGG + Intergenic
912525150 1:110277371-110277393 TTTCTTCTTTCTTAAAGAAAAGG - Intronic
913120414 1:115735261-115735283 TATAGCTTTTGGTGAAGAAATGG + Intronic
913275842 1:117137007-117137029 TATCTGCTCAGATAAAGAAAAGG - Intergenic
913573218 1:120142344-120142366 TATCTCCTTTGATAGCAAAAGGG + Intergenic
914294476 1:146307141-146307163 TATCTCCTTTGATAGCAAAAGGG + Intergenic
914383261 1:147140129-147140151 TATCTCAATAGATAAAGAAAAGG - Intergenic
914555520 1:148757924-148757946 TATCTCCTTTGATAGCAAAAGGG + Intergenic
914948596 1:152089342-152089364 TATGTCCTTAGGTTAAAAAATGG - Intergenic
915379665 1:155428747-155428769 TATCTCTTATGGGAAACAAAGGG - Intronic
916091126 1:161308650-161308672 TATCTCCCTTGTTAAACAAGGGG - Intronic
917280072 1:173371517-173371539 TATTGCCTTTGATAAGGAAAAGG - Intergenic
917626452 1:176851250-176851272 TATCACCTTTGGCAAAGGAATGG - Intergenic
918325258 1:183403955-183403977 TTTCTCCTTTTGTGAAGAAATGG + Intronic
918784073 1:188742107-188742129 TATATCCATTGATGAAGAAATGG + Intergenic
919338719 1:196274878-196274900 TTTGTCCTTTGGTTAAGAAAAGG - Intronic
920568612 1:206998226-206998248 TGTATACTTTGGTAAAGACAGGG + Intergenic
922002169 1:221490539-221490561 TAACTGCTGTGGAAAAGAAAAGG + Intergenic
922210557 1:223483449-223483471 TATCTCTTTGGAAAAAGAAAAGG - Intergenic
923170651 1:231413811-231413833 ATTTTGCTTTGGTAAAGAAATGG + Intronic
923831247 1:237559975-237559997 CCTCTCCTTTGGTAAAGACTGGG - Intronic
924005357 1:239603640-239603662 TATTTCCTCTGGTAAAGCAAAGG - Intronic
924081378 1:240401716-240401738 CTTCTCTTTTGGTACAGAAAAGG - Intronic
924266208 1:242284838-242284860 TATCTGCTTTGGGAATTAAATGG - Intronic
924373258 1:243378704-243378726 TATTTCCTTAGGTAGAGAGAAGG - Exonic
1063212956 10:3898010-3898032 AATCTCCTTTAAAAAAGAAATGG - Intergenic
1063384083 10:5605013-5605035 TTTCTCCTTTTTCAAAGAAAAGG - Intergenic
1063504883 10:6588525-6588547 TAGCTCCCTTGGCAAAGCAACGG - Intergenic
1063862409 10:10325576-10325598 TGTCCACTTAGGTAAAGAAATGG - Intergenic
1064020234 10:11803316-11803338 TATTTCCTTTGGGGAAGAAGAGG + Intergenic
1064076271 10:12271363-12271385 TATCTCCTCTTGCTAAGAAAAGG - Intergenic
1064674506 10:17747835-17747857 TTTCTTCTTTGCTAGAGAAAGGG - Intergenic
1065252961 10:23835508-23835530 TATCACCTTGGATAAGGAAAAGG - Intronic
1065340454 10:24699667-24699689 TATATCCTTCGGTAAAGAGAAGG + Intronic
1066718622 10:38313722-38313744 TATCTGCTTTGGGAATTAAATGG + Intergenic
1067983005 10:51108537-51108559 CATCTCCATTGGCACAGAAAAGG + Intronic
1068207122 10:53870020-53870042 TATCACATTTGGAAAAGAAAAGG + Intronic
1068800411 10:61133902-61133924 TATGTTCTATGGGAAAGAAAAGG - Intergenic
1068948222 10:62750926-62750948 TATTTTCTTTGGAAAAAAAAAGG - Intergenic
1069086803 10:64150263-64150285 TATCTCCCTAGGGAAAGAAATGG - Intergenic
1070119326 10:73560326-73560348 TTTCTCATTTGGTAAGGGAAGGG - Intronic
1070272997 10:74976092-74976114 TATCTCTTTTGCCAAAGAAGTGG - Exonic
1070671810 10:78382759-78382781 CATCTCATTTGTTTAAGAAAAGG - Intergenic
1070726760 10:78797330-78797352 TATCTCCTTTGTGAACGAAGAGG + Intergenic
1071398089 10:85242865-85242887 TCACTGCTTTGGAAAAGAAAAGG - Intergenic
1071711191 10:88051219-88051241 TGTCTCCTTGGTTAAAAAAATGG + Intergenic
1071731560 10:88253602-88253624 AAACTCCTTTGGTAATAAAAAGG - Intergenic
1072183701 10:93013781-93013803 CATTTGCTTTGGTAAAGAATAGG - Intronic
1074249032 10:111725160-111725182 TATCTCCTTTGAGATGGAAAAGG + Intergenic
1075126552 10:119704915-119704937 TATCTATTTTTGTAAAGACAGGG - Intergenic
1076432727 10:130418274-130418296 AATCTTCTTTGATACAGAAAAGG - Intergenic
1078966018 11:16344035-16344057 TAATTCCTTTGCTAAGGAAAGGG - Intronic
1079527473 11:21407848-21407870 GATCTCAGTTGGCAAAGAAAAGG - Intronic
1080634455 11:34111432-34111454 TCTCTCTTTTGGTAAAGGAAAGG + Intronic
1083902173 11:65648889-65648911 CATCTGCTTTAGAAAAGAAAAGG + Intronic
1086167089 11:83791426-83791448 TAGCTGCTATGGTAAAGATATGG - Intronic
1086350928 11:85942688-85942710 TATCTGCTTGGGTAAAACAAAGG + Intergenic
1086903400 11:92392644-92392666 TAACTCCTTTACTACAGAAAGGG + Intronic
1087237992 11:95741596-95741618 TAGCTCCTTTGGTACAGCGATGG - Intergenic
1087488624 11:98792955-98792977 GATTTCCTTTGGTGGAGAAAAGG + Intergenic
1087627136 11:100607932-100607954 TATCTCCATAGATACAGAAAAGG + Intergenic
1088259648 11:107932033-107932055 TATCTTTTTTTGTAAAGACAGGG + Intronic
1088528967 11:110787285-110787307 TATCTCCTTTGGTTCCCAAATGG + Intergenic
1089456152 11:118627091-118627113 TTTCTCCTTCTGTAAAGGAAGGG - Intronic
1089739122 11:120569990-120570012 TAACTCCTTTGCTATGGAAATGG - Intronic
1089755650 11:120684632-120684654 TGACTACTCTGGTAAAGAAAGGG - Intronic
1091055466 11:132414305-132414327 CATCTGCTTTTCTAAAGAAATGG - Intergenic
1093207795 12:16271168-16271190 TATTTCCTTTGGGAAACAGAGGG - Intronic
1093466887 12:19458618-19458640 TATTACCTTTGCCAAAGAAAAGG - Intronic
1093772109 12:23030246-23030268 TATCTCTTATGATAAAGAAAGGG + Intergenic
1093995555 12:25637778-25637800 TATCTTTTTTGGAAAAAAAAGGG - Intronic
1095639507 12:44471365-44471387 AATCTACTTTGGTATAGATATGG + Intergenic
1095780918 12:46058802-46058824 TATCTCTTTTGGGAAACGAAGGG + Intergenic
1095898401 12:47303573-47303595 TTTCTCTTTTTGTAAAGACAAGG + Intergenic
1097548528 12:61036400-61036422 TTTCTCTTTTGTTAAATAAATGG - Intergenic
1097590847 12:61573469-61573491 TAACTGCCTTGGTGAAGAAATGG + Intergenic
1098940375 12:76527799-76527821 TTCCTCCTTAGGAAAAGAAAAGG - Intronic
1099668674 12:85662312-85662334 TCTCTACTCTGGTAAATAAAAGG + Intergenic
1100829401 12:98503976-98503998 GAAATCATTTGGTAAAGAAAAGG + Intergenic
1100890228 12:99117430-99117452 TATCTCAGTAGGTACAGAAAAGG - Intronic
1101905887 12:108826194-108826216 TATTTCCTTTGGAAAAAAAAAGG + Intronic
1102525680 12:113510872-113510894 TTTCTCTTTTGGTAGAGAAGAGG - Intergenic
1102729770 12:115098200-115098222 TATTTTCTATGGTAAAGACATGG + Intergenic
1103233773 12:119354568-119354590 TTTCTGCTTTAGCAAAGAAACGG + Intronic
1103749197 12:123147936-123147958 TTTCTCCTTTGATAATGAAAAGG - Intronic
1105412393 13:20181733-20181755 TCTCTCCTTTGGAAAAGGCAGGG + Intergenic
1105529783 13:21208937-21208959 TATCAGCTCTGGTAAAGACAGGG - Intergenic
1106095283 13:26637953-26637975 TATCACCTATGTGAAAGAAAAGG + Intronic
1106148266 13:27071820-27071842 CATATCCTTTTATAAAGAAAAGG - Intronic
1106853106 13:33816913-33816935 TCTCTCCTTTGGAATTGAAATGG - Intergenic
1106956616 13:34944662-34944684 TATCTTCTTTTAAAAAGAAATGG - Intronic
1107208161 13:37820695-37820717 TATCTCCATAGATGAAGAAAAGG + Intronic
1108064973 13:46568097-46568119 CATCACCTTTGGATAAGAAAAGG + Intronic
1108342817 13:49514580-49514602 TTTCTTTTTTGGTAAAGACAGGG - Intronic
1108838593 13:54583202-54583224 AATGTCCTATGGAAAAGAAATGG + Intergenic
1109237272 13:59839893-59839915 TATCTACAATGGGAAAGAAAAGG + Intronic
1109955089 13:69555252-69555274 TATTTCCATTAGTAAAGTAAAGG - Intergenic
1110226148 13:73121703-73121725 GATCTCCTTTGGTATTCAAATGG + Intergenic
1110760932 13:79229328-79229350 TACCTCTTGGGGTAAAGAAAAGG + Intergenic
1110869705 13:80436025-80436047 TATCTCTTTTGGTTGACAAAGGG - Intergenic
1111185033 13:84722952-84722974 TATGTCCTTGGTTAAAAAAAAGG + Intergenic
1111401601 13:87743986-87744008 TATGTCATTTGGTTAAGAATTGG - Intergenic
1114964620 14:27941787-27941809 TATCTCAATAGGTACAGAAAAGG + Intergenic
1115184692 14:30672496-30672518 TTTCTCCTTTAAGAAAGAAAAGG - Intronic
1115888118 14:37996290-37996312 TTTTTCCTTTGTTAAGGAAAAGG - Intronic
1116708739 14:48337544-48337566 TATCTCCATAGATGAAGAAAAGG - Intergenic
1118081824 14:62369916-62369938 CATCACCTTTGCTAAACAAAGGG - Intergenic
1119052153 14:71380243-71380265 TATGTCCTTTGATAATTAAATGG + Intronic
1119537817 14:75417234-75417256 TATCCCCTTTGGTAAAGGGGAGG - Intergenic
1120701969 14:87707852-87707874 TTTCTCCTCTGGAAAAAAAATGG + Intergenic
1121476003 14:94203438-94203460 TATGTCCTTAAGTGAAGAAACGG - Intronic
1123134414 14:106013684-106013706 AATCTTCTGTGGTAAAGCAAAGG + Intergenic
1123584442 15:21744125-21744147 AATCTTCTGTGGTAAAGCAAAGG + Intergenic
1123621089 15:22186736-22186758 AATCTTCTGTGGTAAAGCAAAGG + Intergenic
1126193369 15:45902638-45902660 TTTCTCCTTTGGTAAAATTAGGG + Intergenic
1126570361 15:50144072-50144094 TGTTTCCTTTGGTAAAACAAAGG - Intronic
1126588285 15:50312246-50312268 TATATCCTGTAGTAAAGAATAGG + Intronic
1126946548 15:53827994-53828016 TTTCTCCTGTGGGACAGAAAGGG + Intergenic
1127721947 15:61711446-61711468 AATTTCCATTGGTAAGGAAATGG + Intergenic
1127786929 15:62363971-62363993 TAACTCTTTTTGTAAAGACAGGG + Intergenic
1128127771 15:65205542-65205564 TTTCTTCTCTGGTAAAGACAAGG + Intronic
1128481589 15:68044865-68044887 AATCTCCTTTGATGAATAAATGG - Intergenic
1129060518 15:72857007-72857029 CATCTCCCTTGTTAAAGAGATGG - Intergenic
1129576476 15:76753253-76753275 TATTTCCATACGTAAAGAAATGG + Intronic
1129580755 15:76807280-76807302 TATCTCAGTTGGTGCAGAAAAGG - Intronic
1130732763 15:86516292-86516314 TATCTTATTTGGTAATAAAATGG + Intronic
1131696938 15:94887823-94887845 TATCCCCTTTGATACAGTAATGG + Intergenic
1131747734 15:95467754-95467776 TATCTCCTTTAGTACATAACTGG - Intergenic
1131785331 15:95906082-95906104 TTTTTCTTTTGGTAAAGAAGAGG - Intergenic
1131844245 15:96471849-96471871 TCTCTCCTTTTGTAAAGACAGGG + Intergenic
1132792223 16:1697923-1697945 TCTCTCCTCTGGGAATGAAAAGG + Intronic
1133131902 16:3681313-3681335 TGTCTCCATTGGCAAAGCAAGGG + Intronic
1133226599 16:4343721-4343743 TTTCCCCGTTGGTAAAGTAAAGG - Intronic
1133647577 16:7778640-7778662 AATCTACTTTGATAAAGCAATGG + Intergenic
1133669281 16:8001972-8001994 TATCTCAATTGGTGCAGAAAAGG - Intergenic
1134848003 16:17457201-17457223 TTCCTCCTTTCTTAAAGAAAAGG - Intronic
1135195036 16:20387238-20387260 TATGTGCTTTGGAAAAGAACAGG + Intronic
1135303222 16:21348214-21348236 CATCTCCTTTGGAAGAGGAAGGG - Intergenic
1136299964 16:29327405-29327427 CATCTCCTTTGGAAGAGGAAGGG - Intergenic
1137307041 16:47212173-47212195 AATCTCCTTTAGAAAAAAAAAGG - Intronic
1137967907 16:52955122-52955144 TATTTTTTTTGGTAGAGAAAGGG - Intergenic
1137982572 16:53082411-53082433 TATTTCTTTGGGTAAAGACAGGG + Intronic
1138423946 16:56917883-56917905 TTTCTTTTTTTGTAAAGAAAGGG - Intergenic
1139184102 16:64783886-64783908 TAGCTCCTTTGCTAAAGATCAGG + Intergenic
1140079130 16:71727961-71727983 TTTTTCCTTTGGTAGAGACAGGG - Intergenic
1140328945 16:74033911-74033933 TAACTGCTTTGAAAAAGAAATGG + Intergenic
1140375457 16:74442162-74442184 TATCTCTTTTGGTACAGACAGGG + Intergenic
1140548840 16:75841080-75841102 TAAGCCCTTTGGTAGAGAAAGGG + Intergenic
1140654584 16:77126321-77126343 TCTCTCCTTTGAGAAAGAACTGG + Intergenic
1142061700 16:88034173-88034195 CATCTCCTTTGGAAGAGGAAGGG - Intronic
1145058050 17:19716050-19716072 TTTCCCCTTTGGAAATGAAATGG + Intronic
1145100746 17:20074733-20074755 TAACTCACTTGGTAAAGGAAAGG - Intronic
1145931905 17:28692012-28692034 CATCTCCTTTTTTAAAAAAAGGG + Intronic
1146538920 17:33677986-33678008 TAAATCCTTTGTTAAAGGAAGGG + Intronic
1149280863 17:55104359-55104381 TATCTCCATAGATAGAGAAAAGG - Intronic
1149432041 17:56602110-56602132 TATTTACTTTGGAACAGAAATGG + Intergenic
1149949359 17:60968771-60968793 TGTCTCCTTTGGCCAAGTAATGG + Intronic
1150094457 17:62360866-62360888 TATCTCCATAGATTAAGAAAAGG + Intergenic
1150826047 17:68476389-68476411 TATCTCTTTTAATAAAGAAAGGG - Intergenic
1150850556 17:68699796-68699818 TTTCTCCTCTGGTACAGAAAAGG + Intergenic
1153045542 18:852531-852553 TATCTTTTTGGGTGAAGAAAAGG + Intergenic
1153763995 18:8357650-8357672 GATCTCCTTAGGCAACGAAATGG + Intronic
1155313824 18:24551679-24551701 CATCTCCTTTGGAAACGAATAGG + Intergenic
1155432538 18:25775659-25775681 TATCTCATTAGGTGCAGAAAAGG + Intergenic
1155655561 18:28188408-28188430 TATCTAATTTTGTAAAGTAAAGG + Intergenic
1156102985 18:33620918-33620940 TGTGTCCTTTGGTAAAAAGAAGG + Intronic
1156348077 18:36276056-36276078 TATATTTTTTGGTAAAGACAGGG + Intergenic
1156895939 18:42245464-42245486 TTTCTCCTTTTTTAAACAAATGG - Intergenic
1157366368 18:47068184-47068206 TAGCTCCTTTCATCAAGAAATGG - Intronic
1159386525 18:67732636-67732658 AACCTTCTTTGGTCAAGAAAGGG - Intergenic
1159564762 18:70036263-70036285 TATCTGCAATGGTAAAGACATGG + Intronic
1159590080 18:70324800-70324822 TAGCTGCTATGGTAAAGATATGG + Exonic
1162184862 19:8897028-8897050 TATCTCCTTTGCTGAAGAAGAGG + Intronic
1162198358 19:9003170-9003192 TATCTTATTTGGGAATGAAATGG - Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163010692 19:14423854-14423876 TTTTTCCTTTGGTAGAGAAGAGG - Intergenic
1163981483 19:20904552-20904574 TTTCTACTGTGGTAAATAAAAGG - Intergenic
1163991683 19:21004515-21004537 TATCATCTTTGGGAAAAAAAGGG + Intergenic
1164747915 19:30629549-30629571 TATCTCTTTTGTAAAAGAAGGGG + Intronic
925663546 2:6228338-6228360 TATGAACTTTGGTAAAAAAAAGG + Intergenic
926017208 2:9464117-9464139 TTTCCCCTTTGGTTAAGAATGGG - Intronic
926749592 2:16188097-16188119 TAACCCCTGTGGAAAAGAAAGGG + Intergenic
926900823 2:17750437-17750459 TCTCTCCTTTTGTAAAAATAAGG - Intronic
926924368 2:17972145-17972167 TAACTTCTTTGGTGAATAAATGG - Intronic
927319723 2:21729048-21729070 TTTCTCATCTGCTAAAGAAATGG + Intergenic
927421909 2:22942885-22942907 CATCCCCTTTGGTGAAGAACTGG + Intergenic
927612347 2:24554050-24554072 TACCTACATTGGTAATGAAAAGG - Intronic
928327710 2:30333346-30333368 AATCCCATGTGGTAAAGAAAGGG + Intergenic
929224563 2:39499873-39499895 TATCTTTATTGGGAAAGAAAAGG - Intergenic
929858780 2:45657646-45657668 CATCTCATTTGGCAAAGAATGGG + Intronic
930373330 2:50532395-50532417 CATCACCTTTGGTAAAGTATTGG - Intronic
930391731 2:50769777-50769799 CATCTGCTTTGGGGAAGAAATGG + Intronic
930522828 2:52489333-52489355 TATCTCAGTTGATACAGAAAAGG - Intergenic
931244783 2:60483248-60483270 TATATCCCGTGGTAGAGAAATGG + Intronic
931326289 2:61228164-61228186 TATCTCTTATGGTTAAGAAAAGG + Intronic
931707745 2:64961611-64961633 TACCTCTTTTGTTAAAGTAAGGG + Intergenic
931747329 2:65301533-65301555 TCTCTCCTTTGGCAGGGAAAAGG + Intergenic
933510186 2:83231187-83231209 TATCTCCTTTGGTATGTATAAGG + Intergenic
935797500 2:106659036-106659058 TTTCTCCTTTAGAAAAAAAAGGG + Intergenic
936085471 2:109465212-109465234 GATGTCCTTTGGTAAGTAAATGG - Intronic
937739532 2:125333710-125333732 TCTCTCCTTTCCTCAAGAAATGG - Intergenic
939130246 2:138226802-138226824 TATTTTCTTTGATGAAGAAATGG - Intergenic
940005287 2:149004416-149004438 TATTTCCTATGGTAAATACATGG + Intronic
941298853 2:163775980-163776002 TATCTCCTTTGTTACAAAAAGGG - Intergenic
941374174 2:164706963-164706985 CCTCTCCTTTGGTAATGGAATGG + Intronic
942195147 2:173509801-173509823 AATCTCCTTTAGTAAAATAAAGG + Intergenic
944136113 2:196401451-196401473 TCTTTCCTTTGGTGAAGAAAGGG + Intronic
944380305 2:199101536-199101558 GATCTCCTTGGGTATATAAAAGG + Intergenic
944568056 2:201011810-201011832 TAGCTCCTTTAGTAAAAACATGG + Intronic
945287049 2:208093397-208093419 AATCTCCCTTGCTAAAGATAAGG - Intergenic
945502183 2:210589820-210589842 TATCTTTTTTGGTAGAGATAGGG + Intronic
945530395 2:210946319-210946341 TATCTCCATTAATAAATAAAGGG - Intergenic
946269738 2:218581121-218581143 TATATTCTATGGAAAAGAAATGG + Intronic
947382248 2:229555816-229555838 GATTACCTTTGGTAGAGAAATGG + Intronic
947614631 2:231547695-231547717 TATTTTCTTTGGTAGAGACAGGG + Intergenic
947970707 2:234321295-234321317 TATCCCCTTTGGTGATGAATTGG - Intergenic
948192143 2:236067912-236067934 TATCTCATCTGGCAAAGAGAAGG + Intronic
1168767611 20:392388-392410 TTTCTCCGTTGGTAAGGAAAAGG + Intronic
1170226605 20:13996871-13996893 TATATCCTTTTGTAAAGATGAGG - Intronic
1172060166 20:32182009-32182031 TTTCTCCTTTGGATGAGAAAAGG + Intergenic
1172456717 20:35081338-35081360 TTTTTCCTTTGGTAGAGACAGGG - Intronic
1173313605 20:41923226-41923248 TATCACCTATGCTAAAGAACAGG + Intergenic
1173412128 20:42821319-42821341 TATCTCAATAGGTACAGAAAAGG + Intronic
1174537648 20:51264753-51264775 TATCTCAATTGATAAAGAAAAGG + Intergenic
1175085436 20:56454509-56454531 AGTCTCCTTTGGTTGAGAAAAGG + Intronic
1175591657 20:60197642-60197664 TATCTCAATAGGTACAGAAAAGG - Intergenic
1176873712 21:14104962-14104984 TATGTACTTTGGTTTAGAAAGGG - Intergenic
1177923215 21:27180801-27180823 TATCTTTCTTTGTAAAGAAAGGG - Intergenic
1178571147 21:33738364-33738386 TATCTCCTTTGTTAGAAATATGG - Intronic
1178597541 21:33968324-33968346 TATCTCCTTAGACACAGAAATGG - Intergenic
1179108879 21:38427881-38427903 TATCTGCTTTACTTAAGAAAAGG + Intronic
1181281772 22:21725818-21725840 TTTTTCCTTTGGTAGAGACAGGG - Intronic
1183950864 22:41352140-41352162 CATCTCCCTTGATGAAGAAACGG + Intronic
1184055203 22:42042887-42042909 TATCTTCTTTGGTAGAGACAGGG - Intronic
1184389985 22:44197902-44197924 TCTCTCCCTTGGTAAAATAATGG + Intronic
1185179563 22:49351319-49351341 TATTTTCTTTCATAAAGAAAGGG + Intergenic
949457314 3:4253221-4253243 TCTCTCCATTGGAAAAAAAATGG + Intronic
949590423 3:5488242-5488264 TTTCTCTTTTTGGAAAGAAAAGG - Intergenic
950036292 3:9888281-9888303 TATTTCTTTTGGTAGAGACAGGG + Intergenic
950222916 3:11210216-11210238 TATCTTTTTTGGTAGAGACAGGG - Intronic
951225914 3:20120902-20120924 TATCTCCCTTGGAAGTGAAAGGG - Intronic
951436219 3:22668046-22668068 TATCTCCTATGGCAAGCAAATGG + Intergenic
951602676 3:24393925-24393947 TATCTCCTTTGGTATTGAAAGGG + Intronic
952010549 3:28895939-28895961 TTTCTCCTTGGAGAAAGAAAAGG - Intergenic
952671776 3:35977188-35977210 ATTCACCTTTGGTGAAGAAATGG + Intergenic
953034040 3:39196383-39196405 TATCTCCACTGTTAAAAAAATGG - Intergenic
953723411 3:45376535-45376557 TATCCCTTTTGGGAAACAAAGGG + Intergenic
957721767 3:84011508-84011530 TATCTCAATAGGTACAGAAAAGG + Intergenic
957821986 3:85388394-85388416 TATCTCCTTCAGGAAAGAAGCGG + Intronic
957850342 3:85799504-85799526 TATCTCAATAGATAAAGAAAAGG - Intronic
958777979 3:98508396-98508418 TATTTCAATTGGTAAAGAAGTGG + Intronic
958809946 3:98849241-98849263 TATTTCCTTTACTAAGGAAAGGG + Intronic
960682062 3:120259599-120259621 TATCTCCTTTCTTACACAAAAGG - Intronic
960802881 3:121556536-121556558 TTTCTCATTTGTAAAAGAAATGG - Intergenic
960826131 3:121786643-121786665 TATCTCCTCTAGCTAAGAAAAGG - Intronic
961033179 3:123624146-123624168 TTTCTCCTTTGGTAGAAACAGGG - Intronic
961137595 3:124526398-124526420 TATCTTTTTTGGTAGAGATAGGG - Intronic
962230127 3:133658021-133658043 CATCAACTTTGGTAAAGAATTGG - Intronic
962762319 3:138526334-138526356 TATTTTTTTTGGTAAAGACAGGG + Intronic
963826637 3:149962440-149962462 TTTCTACTTTGGAAAATAAACGG + Intronic
963910544 3:150813885-150813907 GATCTCCTTTGGCCAAGAAGGGG + Intergenic
965343808 3:167522436-167522458 TATCTCTTTTAGGAAGGAAAAGG + Exonic
965344560 3:167532529-167532551 GATACCCTTTGGTAAAAAAATGG - Intronic
966154723 3:176903261-176903283 TACCTCCTTTGGGAAAGTGAAGG - Intergenic
966730909 3:183150732-183150754 TGTTTTCTTTGGTAAAGACAGGG + Intronic
967183389 3:186925982-186926004 TCTCTCTTTTAATAAAGAAAAGG + Intergenic
970216345 4:13762840-13762862 TAGCTCCCTTGGGTAAGAAAAGG - Intergenic
970811012 4:20094002-20094024 AATTTCCATTGGTGAAGAAAGGG - Intergenic
971596473 4:28535506-28535528 TCTCACCTTTTGTAAAGAAACGG - Intergenic
972408036 4:38765049-38765071 TATCTTTTTTGGTAGAGACAGGG - Intergenic
973019552 4:45185615-45185637 TATTTCCTTTGAAAAAGAACTGG + Intergenic
973536072 4:51883301-51883323 TGTCTTATCTGGTAAAGAAAGGG + Intronic
973945657 4:55952310-55952332 TTCATGCTTTGGTAAAGAAAAGG + Intronic
974133205 4:57782046-57782068 TATCTCAATTAGAAAAGAAATGG - Intergenic
974264171 4:59562773-59562795 TATCTCCTATGGAATAAAAAAGG - Intergenic
974495479 4:62621113-62621135 AAACTCTTTTGGTAAGGAAACGG + Intergenic
975461033 4:74653103-74653125 TATCTTCTTTTGTAAAGCATGGG + Intergenic
975477425 4:74839931-74839953 TATCTCCTTTATGAAAAAAATGG - Intergenic
975983935 4:80186135-80186157 TTTCCCGTTTGGTATAGAAAAGG + Intronic
975996595 4:80322262-80322284 TTGCTCCTTGGGTAAATAAAAGG + Intronic
976032421 4:80772225-80772247 TATCACGTTTTGTAAAGCAAAGG - Intronic
976120622 4:81776976-81776998 TATCTCCCTTGGGAAAGTAGTGG - Intronic
976121113 4:81783216-81783238 TATTTGCTTTAGTATAGAAATGG - Intronic
977093066 4:92703854-92703876 TATATCTATTGGTAGAGAAATGG + Intronic
977872953 4:102114843-102114865 TATTTATTTTAGTAAAGAAAAGG + Intergenic
978441223 4:108736097-108736119 TGTCTCCTTTTGTAGAGACAGGG + Intergenic
978605014 4:110470202-110470224 TATTACCTAAGGTAAAGAAAGGG + Intronic
979128802 4:117012723-117012745 TATCTTCTTTATTAAAGAACTGG - Intergenic
979442205 4:120764077-120764099 TTTTTCCTTTGGAAAATAAAAGG - Intronic
979667914 4:123332889-123332911 TATCTCAATTGATACAGAAAAGG - Intergenic
981184189 4:141781725-141781747 TATATTTTTTTGTAAAGAAATGG - Intergenic
981678396 4:147365839-147365861 TACCTACATTGGTCAAGAAAAGG + Intergenic
981809545 4:148758092-148758114 TTTCTTCTTTGGGAGAGAAAAGG + Intergenic
982132033 4:152238042-152238064 TGTTTCCTTTTGTGAAGAAATGG + Intergenic
982239280 4:153282518-153282540 TATTTACTTTTGTAGAGAAAGGG - Intronic
982914849 4:161194532-161194554 TATCACATTTGGAAAAGATAAGG - Intergenic
982946763 4:161634259-161634281 GACCTCCTTTCCTAAAGAAAGGG + Intronic
983093913 4:163539932-163539954 TATTTCCTTTGGTAATAGAATGG + Intronic
983277700 4:165638316-165638338 TATTTCCTTTAGTAGAGACAGGG + Intergenic
983381888 4:167005798-167005820 AATCTCATTTGATAAAGAAAAGG + Intronic
983897370 4:173096164-173096186 TATCTCATTTGGTAAGGGAGAGG + Intergenic
984807280 4:183763304-183763326 GATCTCCTTTGCTAAAGTTAAGG - Intergenic
984900071 4:184578453-184578475 TATTTCTTTTTGTAAAGATAGGG - Intergenic
986939286 5:12930889-12930911 TATCTCCTCATGTAAAAAAAAGG + Intergenic
987201985 5:15586407-15586429 TTTGTGCTTTGGGAAAGAAAAGG - Intronic
987837035 5:23175252-23175274 TATCTCAATTGATACAGAAAAGG - Intergenic
988772219 5:34444022-34444044 TATCTCAATAGGTACAGAAAAGG - Intergenic
990196145 5:53318653-53318675 TACCTGCTTTGGGAGAGAAATGG + Intergenic
990430181 5:55726868-55726890 TTTTTCCTTTTTTAAAGAAACGG + Intronic
990809922 5:59711865-59711887 AATTTTCTTTGGTAAGGAAAGGG + Intronic
990920822 5:60964622-60964644 TATATTCTTTGGTAGAGACAGGG + Intronic
991215656 5:64155321-64155343 TATCTTCTCAGGGAAAGAAAGGG + Intergenic
991488025 5:67158092-67158114 TATTTCCTGTGGTGAAGGAAAGG - Intronic
992322376 5:75626369-75626391 TATCTCCTTATGTAAAGAAAAGG - Intronic
992359655 5:76024062-76024084 AATCTCCATTACTAAAGAAATGG - Intergenic
994376719 5:99023244-99023266 TATTTCATTTTTTAAAGAAAAGG - Intergenic
994790556 5:104221262-104221284 TAACTTCTTTGGGAAGGAAAAGG - Intergenic
995820288 5:116222341-116222363 AATCTCTTTTGGTAAAAACATGG + Intronic
996796853 5:127356941-127356963 TATGTTCTTGGGGAAAGAAAAGG - Intronic
997550857 5:134751852-134751874 TATATTCTTTAGTAAAGACAGGG + Exonic
997611630 5:135219777-135219799 AAGCTCCTTTGATAAAGCAAAGG + Intronic
998447497 5:142210086-142210108 TATCTTTTTTGGTAGAGACAGGG - Intergenic
998654968 5:144168561-144168583 TATCTCTTTTGATAAATTAATGG - Intronic
999065134 5:148677341-148677363 ATTCTCCTATGGCAAAGAAAGGG - Intergenic
999387860 5:151167965-151167987 AATTTCCTTTGGCAAAGGAATGG + Intergenic
1000073215 5:157760840-157760862 TGTGGACTTTGGTAAAGAAAAGG - Intergenic
1001044537 5:168361697-168361719 TTTCCTCATTGGTAAAGAAAGGG + Intronic
1001097990 5:168790630-168790652 TATTTATTTTGTTAAAGAAAAGG - Intronic
1002113627 5:176939078-176939100 TATTTTCTTTTGTAGAGAAAGGG - Intronic
1003721273 6:8705469-8705491 TGTCTTCTTTTTTAAAGAAAAGG - Intergenic
1003733365 6:8850823-8850845 TATTTCCCTTGACAAAGAAAAGG - Intergenic
1003760439 6:9173315-9173337 GATCTGCTTTGGTCAAGAATAGG + Intergenic
1003981528 6:11394811-11394833 TACCTCCTGGGGTTAAGAAAAGG + Intergenic
1004702029 6:18088233-18088255 TATCTCCTTGAGTAATGAGAAGG + Intergenic
1004830283 6:19469768-19469790 TTTCTATCTTGGTAAAGAAAAGG - Intergenic
1005305007 6:24505145-24505167 TAGCTCTTTTGGGAAAAAAATGG + Intronic
1006139304 6:31918413-31918435 TATTTACTTTTGTAAAGACAGGG - Intronic
1006867163 6:37218107-37218129 TACCTCTTATGGGAAAGAAAAGG + Intronic
1007143594 6:39603464-39603486 TATCTCCTGCTGTATAGAAAAGG - Intronic
1007997091 6:46319554-46319576 TATCACATTTGGTAAAGACAAGG - Intronic
1008519973 6:52353992-52354014 TATCTTCTTTGAAAAAAAAAAGG + Intergenic
1009427686 6:63532495-63532517 TAGCTGCCTTGGTATAGAAAAGG - Intronic
1009539747 6:64938918-64938940 TATCTCCCTTGGAATAGTAAAGG + Intronic
1009655952 6:66544842-66544864 TATCTCAATAGGTATAGAAAAGG + Intergenic
1010698283 6:79006141-79006163 TGCCTCCTTTAGTAAACAAATGG - Intronic
1010827515 6:80491559-80491581 CATGTCCTTTGGTAAATGAATGG + Intergenic
1011562529 6:88635940-88635962 TCTCTTCTTTGGTACAGAAATGG + Intronic
1011576373 6:88805207-88805229 TGTCTTCTTTGGTAGAGAAAAGG + Intronic
1011831167 6:91373467-91373489 TATCTCAATTGATACAGAAAAGG - Intergenic
1012234443 6:96797034-96797056 TATTTTCTTTTGTAAAGACAAGG - Exonic
1013968170 6:115981734-115981756 TATCTCCTTTGGAAATACAAAGG + Intronic
1015072460 6:129111743-129111765 TTACTAATTTGGTAAAGAAAAGG - Intronic
1016102400 6:140118641-140118663 TATCTCCATTGATGCAGAAAAGG + Intergenic
1017681451 6:156868341-156868363 AACCTCCTGTGATAAAGAAATGG + Intronic
1017875279 6:158519168-158519190 TATCCCATTTAGCAAAGAAATGG - Intergenic
1018550107 6:164986719-164986741 TATTTCATTTGGTAATGATATGG + Intergenic
1020779935 7:12504430-12504452 TAGCTTCTTTTGTAAAGCAAAGG + Intergenic
1021370705 7:19842303-19842325 TATCTTCATTTGTAAAGTAAGGG - Intergenic
1022422063 7:30232645-30232667 TAGCTCCTTTCCTTAAGAAATGG + Intergenic
1022742639 7:33137559-33137581 AATTTCCTTTGATAAAAAAATGG - Intronic
1022801991 7:33785676-33785698 TATCTCCTTTTGGGAATAAAGGG - Intergenic
1023486324 7:40691034-40691056 TATTTCCTCTGGAATAGAAAAGG + Intronic
1024900011 7:54308261-54308283 TATCTCAATAGATAAAGAAAAGG - Intergenic
1024912019 7:54457186-54457208 TATCTCTTATGGGAAACAAAGGG + Intergenic
1026080700 7:67217087-67217109 TATCTTCTTTGGAAAAGAATTGG + Intronic
1026238505 7:68550695-68550717 TAACTCTTTTTGTAAAGACATGG - Intergenic
1026315057 7:69220699-69220721 TATCTTCATTTATAAAGAAAGGG + Intergenic
1026393158 7:69923090-69923112 TATACCTTTTGGAAAAGAAAAGG - Intronic
1026696389 7:72596944-72596966 TATCTTCTTTGGAAAAGAATTGG - Intronic
1026971324 7:74469917-74469939 TATCTTTTTTGGTAGAGACAGGG - Intronic
1027775933 7:82464078-82464100 TATCTTCCTTGAGAAAGAAAGGG + Intergenic
1027858320 7:83541506-83541528 TCTCTCCTCTGCTCAAGAAAAGG + Intronic
1028104286 7:86858693-86858715 TATTTCTGTTGGTAAAGTAATGG + Intronic
1028275603 7:88852981-88853003 TCACTCCTCTGGTACAGAAATGG - Intronic
1028803736 7:94999347-94999369 TATGGCCTATGGTATAGAAATGG + Intronic
1030288869 7:107852540-107852562 TATCTACTTTGGTAGAGACAGGG - Intergenic
1030318570 7:108141278-108141300 TATCTGGTTTTTTAAAGAAAAGG + Intergenic
1031684367 7:124714862-124714884 TATCTCAATAGATAAAGAAAAGG + Intergenic
1031739636 7:125413878-125413900 TATCTTATTTGGGAATGAAATGG - Intergenic
1032818997 7:135507104-135507126 CAACTCATTTGTTAAAGAAAGGG - Intronic
1033713142 7:143970144-143970166 TATATCCATCAGTAAAGAAATGG - Intergenic
1033741031 7:144276112-144276134 TATCACCTTTGGTATAAAAGTGG - Intergenic
1033752875 7:144373502-144373524 TATCACCTTTGGTATAAAAGTGG + Intronic
1034080023 7:148268020-148268042 AATCTCCTCTGGTGAAGAGAGGG - Intronic
1034371423 7:150600981-150601003 TATCTCAATAGATAAAGAAAAGG + Intergenic
1034611640 7:152375831-152375853 TTTTTCCTTTGGTTGAGAAAGGG + Intronic
1034761159 7:153673105-153673127 TCTTACCTTTGGGAAAGAAATGG + Intergenic
1037118241 8:15251867-15251889 TGCCTCCTTTGCTAAAGTAATGG + Intergenic
1038779585 8:30558475-30558497 TAGCTGCTTTGGTAAGGAAGGGG - Intronic
1039057858 8:33550909-33550931 TATCTCCTTTGGCCAAATAATGG - Intronic
1040014001 8:42685985-42686007 TATCTCAATAGATAAAGAAAAGG + Intergenic
1040397937 8:47017174-47017196 TATCTCCTCTGGTTAACATATGG + Intergenic
1041002071 8:53463234-53463256 TATTGCCTTTGATAAGGAAAAGG - Intergenic
1041881331 8:62753419-62753441 TATCACATGTGGCAAAGAAAGGG + Intronic
1042008368 8:64209142-64209164 CCTCCCCTTTGGTAAAGAACAGG - Intergenic
1042576520 8:70226569-70226591 TATTTTCTTTGGTAAACCAAAGG + Intronic
1043374365 8:79631881-79631903 TATTTCCTTATGAAAAGAAAAGG + Intronic
1043614581 8:82109693-82109715 TTTCTTCTTAGGGAAAGAAAAGG + Intergenic
1043805532 8:84668066-84668088 TACCTCCTTTGATGATGAAAAGG + Intronic
1044027709 8:87194573-87194595 TATCCCCTTTGGAAAATATAAGG + Intronic
1044038245 8:87333608-87333630 TATCTCAATAGGTACAGAAAAGG - Intronic
1044184789 8:89238548-89238570 TATCATCTTTGGGAAAAAAAAGG - Intergenic
1044272384 8:90261643-90261665 TATCTTCTTTGGTGAAGTATAGG - Intergenic
1044322971 8:90826096-90826118 AAATTCCTTAGGTAAAGAAAGGG + Intronic
1045093016 8:98766586-98766608 TTTCTTTTTTGGTAGAGAAAGGG + Intronic
1045565897 8:103314780-103314802 TATCTGCTTTAGTAAATGAACGG - Intronic
1045730197 8:105229657-105229679 TCTCTCTTTAGGGAAAGAAATGG + Intronic
1046020073 8:108654467-108654489 TATGTTCTTAGGTAAAGAAAGGG + Intronic
1047059622 8:121210067-121210089 TCTCTTCTTTGCTAAACAAAAGG - Intergenic
1047197460 8:122734526-122734548 TCTCATATTTGGTAAAGAAAGGG + Intergenic
1047702475 8:127463300-127463322 AAACTTCTTTTGTAAAGAAATGG - Intergenic
1048818758 8:138359877-138359899 TTTCCACTTTGGTAGAGAAAAGG + Intronic
1049127401 8:140804411-140804433 TTTTTCTTTTGGTAGAGAAAGGG - Intronic
1051157075 9:14159971-14159993 TATTTCCTTTGGTAGACGAAGGG - Intronic
1052159974 9:25246073-25246095 TAACTCCTGTGAGAAAGAAAGGG - Intergenic
1052360634 9:27552700-27552722 TATCTCAATAGGTAGAGAAAAGG - Intronic
1052398816 9:27974795-27974817 TATCACCTTAGAGAAAGAAAGGG + Intronic
1052734440 9:32325814-32325836 TATCTCCTTTGGGAAGGAGGAGG - Intergenic
1053280636 9:36818154-36818176 TTTCTCCTTTCGTAGAGACAGGG - Intergenic
1053534073 9:38908394-38908416 TATCTCCAGTGATAAATAAAGGG - Intergenic
1054206297 9:62132813-62132835 TATCTCCAGTGATAAATAAAGGG - Intergenic
1054334371 9:63790952-63790974 TATCTCCATAGATATAGAAAAGG + Intergenic
1054632060 9:67455533-67455555 TATCTCCAGTGATAAATAAAGGG + Intergenic
1055602378 9:77933283-77933305 AATCTCCTTAGCTAAAGAAAAGG + Intronic
1055958747 9:81799541-81799563 TATCAACTTTAGTAAAGAAGAGG - Intergenic
1057357467 9:94343789-94343811 TTTCTCCTAAGGTAAAAAAATGG - Intergenic
1057650284 9:96913837-96913859 TTTCTCCTAAGGTAAAAAAATGG + Intronic
1058001285 9:99868633-99868655 TGCCTCCTGAGGTAAAGAAATGG - Intergenic
1058077213 9:100663215-100663237 TATCTGCTTGGCTATAGAAAGGG - Intergenic
1058267514 9:102922879-102922901 CATCTCTCTTGGTAAAGCAAGGG - Intergenic
1058359763 9:104130865-104130887 CTTCTCCTCTGGTAAAGAGATGG - Intronic
1058389677 9:104480803-104480825 TTTCTCCTATGGTAAAGGAAAGG - Intergenic
1058569167 9:106322473-106322495 TATCTTCTTTAAAAAAGAAAAGG - Intergenic
1059067795 9:111103578-111103600 AATCTCCTTTTATAAATAAATGG - Intergenic
1061507929 9:131042425-131042447 TATCTGCTGTGGGTAAGAAAGGG - Intronic
1061805592 9:133135970-133135992 CATCTCCTTCAGTAGAGAAATGG - Intronic
1062090303 9:134674126-134674148 TTTGTCCTGTGGTAAAGGAAGGG - Intronic
1186268656 X:7860420-7860442 TAAAACCTTTGGTAAAGAAAGGG + Intergenic
1186664905 X:11707113-11707135 CACCACCTTTTGTAAAGAAAAGG + Intergenic
1186871231 X:13775881-13775903 AATATCCCTTGGCAAAGAAATGG + Intronic
1187627875 X:21137120-21137142 AATCTACATTGGGAAAGAAAAGG + Intergenic
1188005093 X:25011575-25011597 TATTTCCTTTTTTAAAGATAAGG + Intronic
1188145001 X:26600702-26600724 TATCACCTGTGGCAAAGATATGG + Intergenic
1188145692 X:26609698-26609720 AATATACTTTGATAAAGAAAAGG + Intergenic
1188529180 X:31119745-31119767 AAAATCCTTGGGTAAAGAAAAGG + Exonic
1189034440 X:37481151-37481173 TATCATCTTTGGAAAAAAAAAGG + Intronic
1189070959 X:37863670-37863692 ATTCTCCTTAGGTAAAGACATGG + Intronic
1189122543 X:38409750-38409772 AATCTACTTTGGTGGAGAAAGGG + Intronic
1189176058 X:38958635-38958657 GATCTCATTTTGTGAAGAAAAGG + Intergenic
1189669332 X:43391199-43391221 TATCTTCTTTGCTAAACATATGG - Intergenic
1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG + Intronic
1192469822 X:71388195-71388217 TATTTTATTTGGCAAAGAAAAGG - Intronic
1193112955 X:77747975-77747997 TTTCACCTTTGATAAAGAAGGGG + Intronic
1193948644 X:87769188-87769210 CATCTCCTTAGGTAAACAAAAGG + Intergenic
1194798023 X:98237079-98237101 TATCTCATTAGATACAGAAAAGG - Intergenic
1194884140 X:99292126-99292148 AAGCTCCTTTGGTAAAGAAATGG + Intergenic
1195547084 X:106124809-106124831 TATAGCCTTTGGAAAAGCAAAGG - Intergenic
1195951564 X:110280138-110280160 TATCCCCTATTTTAAAGAAAGGG + Intronic
1196305861 X:114102422-114102444 TTTCCCCTTTCATAAAGAAACGG + Intergenic
1196484776 X:116193241-116193263 TATCTCAGTTGGTTAATAAAAGG + Intergenic
1197465019 X:126793338-126793360 TATTTCTTTTGGTATAGGAAGGG + Intergenic
1198059953 X:133035699-133035721 TGTCTCATTTGGAAAAGACAAGG - Intronic
1198555474 X:137788721-137788743 GTGCTCCTATGGTAAAGAAAGGG - Intergenic
1198587008 X:138133185-138133207 TAACTCCTTGGAGAAAGAAAAGG + Intergenic
1198608947 X:138375597-138375619 GATCTTTTTTGGTCAAGAAAAGG + Intergenic
1198742345 X:139854442-139854464 TATCACCTTTAGGAAAAAAAAGG + Intronic
1198888833 X:141369558-141369580 TATCTCCGTAGATACAGAAAAGG + Intergenic
1201408556 Y:13673869-13673891 TATTTCTTTTGGGAAATAAAGGG + Intergenic
1201927772 Y:19308140-19308162 TCTCTCCCTTTGTAAAGAAGAGG - Intergenic