ID: 1190114856

View in Genome Browser
Species Human (GRCh38)
Location X:47619759-47619781
Sequence GTGGTCTGGCCAGGAGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190114840_1190114856 22 Left 1190114840 X:47619714-47619736 CCGCAGGTAGTTCATGGCTGCGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1190114856 X:47619759-47619781 GTGGTCTGGCCAGGAGCCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190114856 Original CRISPR GTGGTCTGGCCAGGAGCCGC GGG Exonic
900431660 1:2605729-2605751 GTGCTCTGCCCAGGAGCTGGTGG + Intronic
900556617 1:3283942-3283964 GCGGTGTGTCCAGGAGACGCAGG + Intronic
900653623 1:3743971-3743993 GTGGGCTGGACAGGAGCCCGGGG + Intergenic
900920652 1:5668080-5668102 GGGAGCTGGCCATGAGCCGCTGG - Intergenic
901784573 1:11616369-11616391 GGGGTCTGGCAGGGAACCGCTGG - Intergenic
902341514 1:15786325-15786347 GTGGTCTGGGCCGAAGCCCCTGG - Intronic
902572606 1:17356362-17356384 TGGGGCTGGCCAGGAGCAGCCGG - Exonic
902578811 1:17395545-17395567 TGGGGCTGGCCAGGAGCAGCAGG - Exonic
903003438 1:20282649-20282671 CTGGCCTGGCCAGGGGCCCCAGG - Intergenic
903446044 1:23423811-23423833 GCGCTCTGGCCAGGACCCTCCGG + Intronic
904642041 1:31938293-31938315 GTCGTCTGTCCGGGAGCGGCTGG - Exonic
904858203 1:33515810-33515832 GGAGTCTGGCCAGGAGCCCAAGG - Exonic
905790916 1:40789000-40789022 GGGGTCTGGGCTGGAGCCACGGG - Intronic
906150628 1:43585464-43585486 GTGGTGTGCCCAGGAGCCTCTGG + Intronic
907269243 1:53280985-53281007 GAGGTGTGGCCAGGAGGGGCAGG - Intronic
910638611 1:89437095-89437117 GTTGGCTGGGCAGGAGCCTCAGG + Intergenic
913606908 1:120475432-120475454 GGGGTCTGGCCAGGAGACTAAGG - Intergenic
913998128 1:143668015-143668037 GTGGTCCTTCCAGGAGCTGCAGG + Intergenic
920201222 1:204261033-204261055 GGGGTCTGGCCAGGAGCCAGAGG - Intronic
1073454663 10:103629293-103629315 GGGGACTGGGCAGCAGCCGCTGG + Intronic
1077134550 11:991959-991981 GTGGGCTGGGCAGGTGCCTCCGG + Intronic
1077298207 11:1835767-1835789 GTGGCCTGGCCTGGAGGCGGGGG + Intronic
1077394360 11:2313840-2313862 GAGGTCTGGCCAGGCACCGAGGG + Intronic
1077410518 11:2401796-2401818 GAGGTCGCTCCAGGAGCCGCGGG + Intronic
1078157984 11:8815085-8815107 GTGGTCTGGCAATGACCCGGTGG - Intronic
1080656812 11:34264803-34264825 GGGGTCTGGCCAGGGCCAGCAGG - Intronic
1080845179 11:36020742-36020764 GTGGGCTGGCCAGGATACCCAGG + Intronic
1083202188 11:61127273-61127295 GAGGTCTACCCAGGAGCCTCGGG + Exonic
1084758449 11:71253047-71253069 GTGGCCTGGGCAGCAGACGCCGG - Intergenic
1085666181 11:78417532-78417554 GAGCTCGGGCCCGGAGCCGCGGG - Intronic
1089215982 11:116835080-116835102 GTGGCATGGCATGGAGCCGCAGG + Intergenic
1090686079 11:129121521-129121543 GTGGACTGGCAAGGTGCAGCTGG + Intronic
1091443709 12:531013-531035 GAGGTCTGGCTAGGAGCAGGAGG + Intronic
1091851011 12:3696927-3696949 GGGGTCTGGCCAGGGGCCAAAGG - Exonic
1092964888 12:13631982-13632004 GTGGTCTGGCCATGAACCCAAGG - Intronic
1093497520 12:19775382-19775404 GAGTTCTGGCCAGGAGGCTCTGG + Intergenic
1101673524 12:106897847-106897869 TGGGTCTGGCCAGGAGCAGAGGG - Intergenic
1104866941 12:131961366-131961388 TTGGGCTGGCCAGGGGCTGCAGG - Exonic
1104881204 12:132071720-132071742 GTGCACAGGCCAGGAGCCGTGGG - Intronic
1104885490 12:132104734-132104756 TTGGGCTGGCCAGGGGCTGCAGG - Exonic
1108637624 13:52351365-52351387 GTGGTCGGGCGCGGAGGCGCAGG - Intergenic
1112146749 13:96708680-96708702 GTGGCCTGGCCAGGATCCTTGGG - Intronic
1113539479 13:111095165-111095187 GTGGACTGGCCAGCACCCCCTGG - Intergenic
1113891904 13:113740383-113740405 GTGGGCTGGCCCTGAGCTGCAGG - Intergenic
1116826485 14:49677858-49677880 GTGTGCTGGCCAGGAGCTGGGGG - Intronic
1119842083 14:77800581-77800603 GTGGTCTGGGCAAGAGCAGGGGG + Intronic
1120190670 14:81436574-81436596 GGGGACTGGCCGGGCGCCGCCGG + Intergenic
1120817167 14:88873160-88873182 GTGGTCTGAGCAGGAGCCAGAGG - Intronic
1122252049 14:100446768-100446790 GTGATCTGGGCAGGTGTCGCTGG + Intronic
1122516811 14:102314634-102314656 GGGGTCGGGCCGGGAACCGCAGG + Intergenic
1123034591 14:105466740-105466762 GGGGTAAGGCCTGGAGCCGCGGG + Exonic
1202904373 14_GL000194v1_random:59920-59942 GAGGCCGAGCCAGGAGCCGCAGG - Intergenic
1123631054 15:22259501-22259523 GTGGCCATGCCAGAAGCCGCGGG + Intergenic
1124011735 15:25844667-25844689 GTGGTCCAGCCAGGAGGGGCAGG - Intronic
1125549760 15:40536601-40536623 GTGATCTGGCCAGGGGGAGCTGG + Intronic
1126721744 15:51588395-51588417 GTGATCTGGCCAGGAGCGCTGGG + Intronic
1129606254 15:77026486-77026508 GTGGTATGGCCAGGACACCCAGG - Intronic
1130543860 15:84840657-84840679 GTGGGCTGGCCAGGAGCGCCAGG - Exonic
1130647887 15:85744705-85744727 GTGGGCTGGCCAGGATCAGGAGG - Exonic
1132709048 16:1258533-1258555 GTGGTTTGGACAGGAGGGGCTGG - Exonic
1132786130 16:1657880-1657902 ATGGACTGGGCAGGAGCTGCAGG + Intronic
1132973454 16:2700227-2700249 GTGGGCTGGCCAGGAGGCTCTGG - Intronic
1134327321 16:13218957-13218979 TTGGTTTGGTCATGAGCCGCCGG + Intronic
1134660190 16:15978176-15978198 GTGGTCTGGCCATGTTCCCCAGG - Intronic
1136572653 16:31105917-31105939 GCGGCGTGGACAGGAGCCGCAGG - Intergenic
1137695454 16:50458985-50459007 GTGGTTGGGCCAGCAGCTGCAGG + Intergenic
1141422359 16:83925366-83925388 GTGGTCTGTCCAGGGGCCCGGGG - Exonic
1141831443 16:86511780-86511802 CTGGTCAGGCCTGGAGCAGCTGG - Intronic
1141971968 16:87491005-87491027 GTGGCCACGCCAGAAGCCGCCGG - Intronic
1142020753 16:87780700-87780722 GAGCTCAGGCCAGGAGCCGAGGG + Intergenic
1142189813 16:88712651-88712673 GTGCTCTGCCCAGGAGCTGGTGG + Exonic
1142260311 16:89039725-89039747 CTGATCTGGCCAGGAGACCCAGG - Intergenic
1142403065 16:89871163-89871185 GTGGTAGGGCCAGGAGAGGCAGG - Exonic
1142583935 17:959104-959126 GATGTATGGCCAGGAGCTGCTGG + Intronic
1142676465 17:1516548-1516570 CTGCTCTGGCCGGGACCCGCTGG - Exonic
1143386080 17:6531470-6531492 GTAGTCTGGCCAGAAGCCATGGG - Intronic
1144626685 17:16847480-16847502 CTGGTCTTTCCAGGAGCCCCAGG + Intergenic
1145152488 17:20519155-20519177 CTGGTCTTTCCAGGAGCCCCAGG + Intergenic
1145794544 17:27647983-27648005 GTGGCCTGTCCAGGAACAGCAGG + Intronic
1147567652 17:41547560-41547582 GAGGTGTGGACAGGAGCAGCAGG - Intergenic
1147865013 17:43546195-43546217 GGCGTCTGGGCTGGAGCCGCGGG + Exonic
1148735572 17:49862899-49862921 GTGGGCTGTCCTGGGGCCGCGGG + Intergenic
1151681565 17:75625322-75625344 ATGGACTGGCCAGGAGCAGCGGG + Intergenic
1152165437 17:78701851-78701873 GCTGTCTGGGCAGGAGCCACAGG - Intronic
1152179179 17:78807193-78807215 GTGCTCTGGGCTGGAGCTGCTGG + Exonic
1152722437 17:81929543-81929565 GGGAGCTGGCCAGGAGCCGCTGG - Intergenic
1159016691 18:63106566-63106588 GTGATCTGGCCATGACCCCCAGG - Intergenic
1160531471 18:79567523-79567545 GTGGTCTGTCCCGGAGCCTGTGG + Intergenic
1160531733 18:79569282-79569304 GTGCTCCCGCCAGGAGCCTCTGG - Intergenic
1160777539 19:862870-862892 GGGGTGTGGCCAGGAGCTGGGGG + Intronic
1160965561 19:1745671-1745693 TTGGGCTGGGCAGGAGCCGTTGG - Intergenic
1161031516 19:2059891-2059913 GGTGTCTGGCCAGGAGCCCGGGG + Intergenic
1163787976 19:19286755-19286777 TAGGTCTGGCCAGGCGCAGCGGG + Intronic
1168121695 19:54255421-54255443 GGGCTCTGGCCAGCAGCCCCAGG - Exonic
925131287 2:1495867-1495889 GGGGTCTGGGCAGACGCCGCAGG + Intronic
925724860 2:6863043-6863065 GTGGTGTGTCCAGGAACCACAGG - Intronic
926062215 2:9811817-9811839 CTGGCCTGGCCGGGAGCCCCCGG - Intergenic
926699399 2:15793247-15793269 GTGGTATGGCCAGGGGCAGGAGG - Intergenic
927850320 2:26494685-26494707 GGGGTCTGCCCAGGAGCACCCGG + Intronic
932403684 2:71499854-71499876 GGGGTGTGGCCAGGACCCACGGG + Intronic
932822782 2:74915618-74915640 GTGGTCAGGCCAGGCTCTGCTGG + Intergenic
933869997 2:86556867-86556889 GTCGTTTGGCCAGGATCTGCGGG + Intronic
934502273 2:94870481-94870503 GAGGCCGAGCCAGGAGCCGCAGG + Intergenic
935558828 2:104540363-104540385 GAGGAGTGGCCAGGAGCCTCAGG - Intergenic
937025529 2:118694087-118694109 GAGGTCTTCCCAGGAGCTGCGGG - Intergenic
946192260 2:218013755-218013777 GGGGTCTGGCCAGGAGTTGGAGG + Intergenic
947612558 2:231532948-231532970 ATGGGCTTGCCAGGAGCTGCGGG - Intergenic
947745944 2:232507399-232507421 CAGGTCTGGGCAAGAGCCGCTGG - Intergenic
948551259 2:238774419-238774441 GTGGCCTGGCCAGATGCTGCAGG + Intergenic
948980417 2:241491642-241491664 GTGGTCTGCCCTGGACACGCTGG - Exonic
1172641453 20:36442756-36442778 GTTGTTTGGCCATGAGCAGCAGG + Exonic
1175718508 20:61271522-61271544 GTGGGCTGGCACGGAGCCACAGG + Intronic
1175740692 20:61417856-61417878 GGGGCCAGGCCAGGAGCAGCAGG + Intronic
1176154855 20:63613943-63613965 GTGGTCTGGACAGGAGGGGGAGG + Intronic
1176230994 20:64032828-64032850 GTGGTCCCCCCAGGAGCAGCAGG + Exonic
1176623741 21:9074687-9074709 GAGGCCGAGCCAGGAGCCGCAGG - Intergenic
1179180524 21:39040987-39041009 GTGGTCAGGCCAGGGACCCCTGG + Intergenic
1179261109 21:39758662-39758684 GTAGTCTGACCAGGAGACCCAGG - Intronic
1179801541 21:43813573-43813595 GGGGCCTGGCCAGGAGCAGGTGG + Intergenic
1179878814 21:44285053-44285075 GTGGCCTGGACAGGAGCTTCCGG - Intergenic
1182252478 22:29012025-29012047 CTGGTCTGGGCCGGAGCAGCTGG + Intronic
1182302362 22:29344320-29344342 GAGGTCTGGCCAGGTGCCCAGGG + Intronic
1182697494 22:32206649-32206671 GTGTGCTGGCCAGGAGCAGAAGG - Intergenic
1184782602 22:46656655-46656677 GGGGTCTGGCCAGCAGCCCAAGG - Intronic
1185128447 22:49024554-49024576 AGGGTCTGGCCAGGAGATGCTGG - Intergenic
1185326133 22:50226703-50226725 GTGGGCTGGGCAGGCGCGGCGGG - Intronic
950767747 3:15286099-15286121 CTGCTCTGGCCAGGGCCCGCCGG - Intronic
953980572 3:47411012-47411034 GTGGACTGGCCAGCAGACGAGGG - Exonic
954439911 3:50516206-50516228 GTGCTCTGGCCAGCAGCCAGGGG + Intergenic
955505879 3:59632701-59632723 ATGGTCTGGCCAGAGGCAGCAGG + Intergenic
960639083 3:119809985-119810007 GTGGTATGGCCCGGAGCCCCAGG + Intronic
961484033 3:127205057-127205079 AGGGTGTGGCCAGGAGCCCCAGG - Intergenic
961953769 3:130778511-130778533 GTGGCATGGCCAGTAGCCCCAGG + Intergenic
962828769 3:139121565-139121587 ATGGTCTGCCCAGGAGTCTCTGG - Intronic
964485592 3:157182324-157182346 TTGGGCTGTCCAGGAGCCGTTGG - Intergenic
966856339 3:184196473-184196495 GTGGTCTGGCCAGGAGAAACAGG - Intronic
968123825 3:196144159-196144181 CTGGTCTGGGCAGGAGCAGAGGG - Intergenic
968472483 4:788391-788413 GTGGTCTGGCCACAGGCGGCTGG - Intronic
976190353 4:82481038-82481060 GAGGTCTGGCCTGGAGCACCTGG + Intergenic
979724330 4:123942443-123942465 CAGGTCTGTCCAGGAGCTGCTGG + Intergenic
983779474 4:171650686-171650708 AGGGCCTGGCCAGGAGCAGCTGG + Intergenic
985092936 4:186382090-186382112 GTGGTGTGGCGAGGAACCGGCGG - Intergenic
985647811 5:1093349-1093371 GAGGCCTGGACAGGAGCTGCAGG + Intronic
985999182 5:3616709-3616731 GTGGCCAGGCCAGGAGATGCTGG - Intergenic
987081725 5:14431260-14431282 GTGGTCTGACCAGCAGTGGCTGG + Intronic
994208498 5:97062147-97062169 GTGGCCTGGCCAGAGGCCTCAGG - Intergenic
997582461 5:135026469-135026491 GAGCTCTGGACTGGAGCCGCTGG + Intergenic
997609806 5:135207880-135207902 GAAGTCTGGCCAGGAGACGAAGG + Intronic
998424765 5:142017131-142017153 GTGATCTGGCCAGGAGTGGTGGG + Intergenic
998460657 5:142307701-142307723 GTCATCTGGCCAGGAGTCCCTGG - Intergenic
998515360 5:142748983-142749005 GTAGTTTGCCCAGGAGCCACAGG + Intergenic
1002025835 5:176395709-176395731 GTGGTCTGGGCAGGGGCTGATGG + Intronic
1002195903 5:177501161-177501183 GAGGCCTGGCCTGGAGCCTCAGG - Intergenic
1003122148 6:3327171-3327193 GTCGCCTGGCCAGGGGCCACTGG + Intronic
1003700817 6:8462752-8462774 CTTGTCTGGCTAGGAGCAGCAGG + Intergenic
1006475374 6:34249299-34249321 GCGGGCGGGCCAGGGGCCGCCGG - Exonic
1009623488 6:66105612-66105634 GTGGTTTTGCCAGGAGCGTCAGG - Intergenic
1011603597 6:89081399-89081421 GGGGTTTGGCCGGGAGCCGCGGG - Exonic
1014303178 6:119709197-119709219 GAGTTCTGGCCAGCAGCCGTGGG - Intergenic
1015996490 6:138999944-138999966 GTGGCCTTGCCATGAGCTGCAGG + Intergenic
1017450389 6:154549362-154549384 GTGGGCGGGGCAGGAGCTGCTGG - Intergenic
1019091395 6:169537811-169537833 GTGGTCTGGACAAAAGCCGGGGG + Intronic
1019342395 7:514716-514738 GTGGTCTGGCCTGGCGCCCGTGG - Intronic
1019536811 7:1533639-1533661 GTGGTCCAGACAGGAGACGCTGG + Intronic
1021111191 7:16696676-16696698 TAGCTCTGGCCAGGAGCTGCTGG - Intronic
1022369038 7:29753121-29753143 GTGGTCTGGGGAGGACCCGGTGG - Intergenic
1024000949 7:45189145-45189167 GTGGACTGGCCAGAGGCTGCTGG + Intergenic
1024246921 7:47477640-47477662 GTGACCTGGCCAGGTGCCACAGG + Intronic
1024473514 7:49787726-49787748 GTGGCCTGGGCAGGAGAAGCAGG + Intronic
1024562646 7:50657381-50657403 GTTGCCATGCCAGGAGCCGCGGG - Intronic
1025956857 7:66189778-66189800 GTGGACTGGCCGTGAGCTGCTGG - Intergenic
1027214339 7:76174134-76174156 CTGGTCTGGGCAGGAGCCAGGGG + Intergenic
1028540781 7:91940622-91940644 GGGGTCAGGCCAGGAGCCTCTGG + Intergenic
1029450982 7:100641689-100641711 GTGCTCTGGCCTGGACCCGGGGG - Exonic
1029707241 7:102282474-102282496 TTGGAAGGGCCAGGAGCCGCTGG - Intronic
1033026677 7:137781228-137781250 GAGGTGTGGCCAGGAGCCTAAGG + Intronic
1034414509 7:150957520-150957542 GTGGTCAGGCCAGCAGCCCAGGG + Intronic
1035167332 7:156999771-156999793 GGGGTCAGGCCGGGGGCCGCGGG - Intronic
1036008287 8:4692169-4692191 GAGGTCAGGCCAGGGGCTGCTGG - Intronic
1038402790 8:27298241-27298263 GTGGTCATGCCAGCAGCCACAGG - Intronic
1038865701 8:31436765-31436787 GAGGTCTGGCCAGGAGACCCTGG - Intergenic
1040594057 8:48820820-48820842 GGTGACTGGCCAGGAGCCACAGG - Intergenic
1042745784 8:72104075-72104097 GTGAGCCAGCCAGGAGCCGCTGG - Intronic
1043813605 8:84774024-84774046 GAGGTCTGGCTAGGAGGCCCAGG - Intronic
1045013886 8:97981919-97981941 GAGGTTTGGCTAGGAGCCACGGG + Intronic
1046337300 8:112806985-112807007 GTGGTCTGGCCAGAGGCAACAGG - Intronic
1048277540 8:133078200-133078222 GTGGTCTGTTCAGGAGTCCCTGG + Intronic
1048449814 8:134523432-134523454 GTGGCCTGGCCAGGAGGCGTGGG - Intronic
1048867293 8:138770344-138770366 GTGGGCTGTCCAGGGGCTGCTGG - Intronic
1049595847 8:143482975-143482997 GCGGCCTGGCCAGGGGCTGCTGG - Intronic
1049610419 8:143552614-143552636 GTGGGGTGCCCAGGAGCTGCTGG + Intergenic
1049688896 8:143950208-143950230 CTGGCCTGGCCAGGGTCCGCTGG + Exonic
1049696780 8:143987937-143987959 GAGGTCTGGTCAGGTGCAGCTGG - Intronic
1051669036 9:19492212-19492234 AAGGTCTGGCCAGGAGCAGAGGG + Intergenic
1056121611 9:83493862-83493884 GTGGCCTGGCCAGGAGGGGATGG - Intronic
1056553363 9:87669747-87669769 GTGGTCTTGCCAGGGGCAGGGGG + Intronic
1056968158 9:91180927-91180949 GTGGGCTTCCCAGGAGCCGTGGG + Intergenic
1058747121 9:108002604-108002626 GTGGTCTGGCAAGGAGCAGGGGG + Intergenic
1061605172 9:131704580-131704602 CTGGTATGGCCTGGAGCTGCTGG + Intronic
1061972064 9:134050298-134050320 GAGGTCAGGGCAGGAGCAGCAGG - Intronic
1062473179 9:136715055-136715077 GGGGTGTGGCCAGGCGCTGCCGG + Intronic
1062503972 9:136863430-136863452 TTGTTCTGGCCAGCAGCCCCTGG + Exonic
1062670988 9:137709319-137709341 GAGGGCTGGCCATGAGCAGCTGG + Intronic
1203746927 Un_GL000218v1:45115-45137 GAGGCCGAGCCAGGAGCCGCAGG - Intergenic
1203367846 Un_KI270442v1:273962-273984 GGGAGCTGGCCATGAGCCGCTGG + Intergenic
1203563179 Un_KI270744v1:74365-74387 GAGGCCGAGCCAGGAGCCGCAGG + Intergenic
1190114856 X:47619759-47619781 GTGGTCTGGCCAGGAGCCGCGGG + Exonic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1200059842 X:153479349-153479371 GTGGGCTGGGCAGCAGCTGCAGG - Intronic
1201070844 Y:10146279-10146301 GGGAGCTGGCCATGAGCCGCTGG - Intergenic
1201160252 Y:11160129-11160151 GAGGCCGAGCCAGGAGCCGCAGG - Intergenic
1201562527 Y:15333231-15333253 GTGGTCTGGAAAGGAGCCTTGGG - Intergenic