ID: 1190115005

View in Genome Browser
Species Human (GRCh38)
Location X:47620433-47620455
Sequence TAGCTGAGCCTGTGTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190115005_1190115012 18 Left 1190115005 X:47620433-47620455 CCACATCCACACAGGCTCAGCTA No data
Right 1190115012 X:47620474-47620496 CACAGACAGCATCAGACAAGCGG No data
1190115005_1190115013 21 Left 1190115005 X:47620433-47620455 CCACATCCACACAGGCTCAGCTA No data
Right 1190115013 X:47620477-47620499 AGACAGCATCAGACAAGCGGAGG No data
1190115005_1190115011 -8 Left 1190115005 X:47620433-47620455 CCACATCCACACAGGCTCAGCTA No data
Right 1190115011 X:47620448-47620470 CTCAGCTAGGCAGAGAGCGGGGG No data
1190115005_1190115009 -10 Left 1190115005 X:47620433-47620455 CCACATCCACACAGGCTCAGCTA No data
Right 1190115009 X:47620446-47620468 GGCTCAGCTAGGCAGAGAGCGGG No data
1190115005_1190115010 -9 Left 1190115005 X:47620433-47620455 CCACATCCACACAGGCTCAGCTA No data
Right 1190115010 X:47620447-47620469 GCTCAGCTAGGCAGAGAGCGGGG No data
1190115005_1190115014 24 Left 1190115005 X:47620433-47620455 CCACATCCACACAGGCTCAGCTA No data
Right 1190115014 X:47620480-47620502 CAGCATCAGACAAGCGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190115005 Original CRISPR TAGCTGAGCCTGTGTGGATG TGG (reversed) Intergenic
No off target data available for this crispr