ID: 1190116236

View in Genome Browser
Species Human (GRCh38)
Location X:47627657-47627679
Sequence GAGGGTAATGGGATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 569}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190116226_1190116236 2 Left 1190116226 X:47627632-47627654 CCGCCCATCTCTGTGGGAGAGAA 0: 1
1: 0
2: 2
3: 25
4: 245
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116219_1190116236 17 Left 1190116219 X:47627617-47627639 CCCCAGCCAGACCAGCCGCCCAT 0: 1
1: 0
2: 3
3: 32
4: 914
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116225_1190116236 6 Left 1190116225 X:47627628-47627650 CCAGCCGCCCATCTCTGTGGGAG 0: 1
1: 0
2: 0
3: 27
4: 200
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116220_1190116236 16 Left 1190116220 X:47627618-47627640 CCCAGCCAGACCAGCCGCCCATC 0: 1
1: 0
2: 1
3: 33
4: 606
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116222_1190116236 11 Left 1190116222 X:47627623-47627645 CCAGACCAGCCGCCCATCTCTGT 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116221_1190116236 15 Left 1190116221 X:47627619-47627641 CCAGCCAGACCAGCCGCCCATCT 0: 1
1: 0
2: 1
3: 15
4: 207
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116228_1190116236 -2 Left 1190116228 X:47627636-47627658 CCATCTCTGTGGGAGAGAAGAGA 0: 1
1: 0
2: 5
3: 31
4: 384
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116216_1190116236 25 Left 1190116216 X:47627609-47627631 CCCAGGGCCCCCAGCCAGACCAG 0: 1
1: 0
2: 5
3: 51
4: 404
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116217_1190116236 24 Left 1190116217 X:47627610-47627632 CCAGGGCCCCCAGCCAGACCAGC 0: 1
1: 1
2: 6
3: 63
4: 637
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116218_1190116236 18 Left 1190116218 X:47627616-47627638 CCCCCAGCCAGACCAGCCGCCCA 0: 1
1: 0
2: 9
3: 378
4: 5097
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569
1190116227_1190116236 -1 Left 1190116227 X:47627635-47627657 CCCATCTCTGTGGGAGAGAAGAG 0: 1
1: 1
2: 1
3: 42
4: 282
Right 1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG 0: 1
1: 0
2: 4
3: 54
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190116236 Original CRISPR GAGGGTAATGGGATGGAGGT GGG Intronic
900123516 1:1059456-1059478 GAGGGTCTTGGAATGGAGGGCGG + Intergenic
900469094 1:2843112-2843134 CAGGGTGATGGGAAGAAGGTTGG + Intergenic
900706939 1:4086854-4086876 GAGGGTAAGGGGACGAAGCTGGG + Intergenic
900740465 1:4327895-4327917 GAGGGTTGTGGATTGGAGGTGGG + Intergenic
901004244 1:6164155-6164177 GAGGGAAGGGAGATGGAGGTGGG - Intronic
901227813 1:7624558-7624580 GAGGGTGATGGGTGGGTGGTGGG + Intronic
901281155 1:8036211-8036233 GAGGGCAATGGGGTGGTGGCGGG + Intergenic
901296041 1:8161650-8161672 CAGGGTGGTGGGATGGAGGATGG - Intergenic
901298821 1:8183400-8183422 GAGGCTAATGGTGGGGAGGTAGG + Intergenic
901843254 1:11966510-11966532 GGGGGTGGTGGGATGGGGGTGGG + Intronic
902170142 1:14603721-14603743 GAGGGTAAAGGGATGGAGAGAGG - Intronic
902202408 1:14843706-14843728 CAGGGTAGTGGGATGAGGGTGGG - Intronic
902661572 1:17907757-17907779 GGGTGTAGTGGGGTGGAGGTGGG + Intergenic
902839663 1:19066971-19066993 GAGGGAAATGGGAAGGTGCTGGG + Intergenic
903344011 1:22673075-22673097 CAGGGTCCTGGGATGGAGCTAGG - Intergenic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
903892054 1:26576312-26576334 TAGGGTGGTGGGATGGAGATTGG + Intergenic
904292536 1:29497324-29497346 ACGGGGAAGGGGATGGAGGTGGG - Intergenic
904873214 1:33634818-33634840 GAGAGGAATGGGATGGAGCTGGG - Intronic
905045342 1:34994307-34994329 GAGAGTGATGGCATGGAGGAGGG + Intronic
905252759 1:36660068-36660090 GAGCCTAGTGGGATGAAGGTGGG - Intergenic
905653939 1:39673887-39673909 GTGGTTACTTGGATGGAGGTGGG + Intergenic
905751369 1:40467570-40467592 AAGGGTAATGGGATGAAGAAAGG - Intergenic
906513463 1:46424436-46424458 GAGCTGAATGGGGTGGAGGTAGG - Intergenic
906515699 1:46437643-46437665 AAGACTGATGGGATGGAGGTGGG + Intergenic
907445057 1:54502099-54502121 GCTGGTAATGTGATGGAGGCTGG - Intergenic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908730049 1:67216892-67216914 GAGGGAAATGGGGTGGTGATGGG - Intronic
908890721 1:68844387-68844409 GAGGGGAATGGAATGGAAGAGGG + Intergenic
909710676 1:78645988-78646010 GAGGGCACAGGGGTGGAGGTGGG + Exonic
909881081 1:80879647-80879669 GGGGGTTGAGGGATGGAGGTTGG - Intergenic
910471389 1:87556761-87556783 AAGAGTGATGGGCTGGAGGTTGG + Intergenic
910608305 1:89111622-89111644 GGGGGTAATGGGGTGGTGGGGGG + Intronic
910739578 1:90500390-90500412 GAGAGGGATGGGATTGAGGTTGG - Intergenic
911055409 1:93704319-93704341 GAGTGTAATGAGGTGGGGGTGGG + Intronic
911064974 1:93780007-93780029 GAGGTCAGTGGGAAGGAGGTTGG - Intronic
911115257 1:94239441-94239463 GAGGGTGTATGGATGGAGGTGGG + Intronic
911542293 1:99172385-99172407 GAGGGTAAGGGGTGGGAGGAGGG - Intergenic
912379963 1:109242071-109242093 GAGGGGAATGGGGTGAAGGAGGG - Intergenic
912688468 1:111785582-111785604 GAAGGTGATAGGCTGGAGGTGGG + Intronic
912756665 1:112329918-112329940 CAGGGCAATGGGATGAAGTTTGG - Intergenic
913186934 1:116376949-116376971 GAGGGTACTGGCATGGAGCATGG - Intronic
914805398 1:150987752-150987774 GATGGAAATGGGATTGAGGGTGG - Intronic
914855416 1:151346935-151346957 GAGGGGGAAGGGAAGGAGGTGGG - Intronic
917206007 1:172571960-172571982 GCCCGTAATGGGAGGGAGGTGGG + Intronic
918215495 1:182389937-182389959 AAGGGTTCTGGGATGGAGGTGGG - Intronic
918412645 1:184275982-184276004 GAGGGTAGTGGGGTGAGGGTGGG + Intergenic
918755099 1:188330559-188330581 AAGGGTAATGGGGTGGTGGTGGG - Intergenic
918956520 1:191215606-191215628 GAGGGTGAAGGGTGGGAGGTGGG + Intergenic
921183947 1:212654331-212654353 AAGGGGAAGGGCATGGAGGTGGG + Intergenic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
921370705 1:214419938-214419960 GAGGATAGAGGGATGGAGGGAGG - Intronic
923141036 1:231162022-231162044 GAGAGTAATGGGGAGGAGGGGGG - Intergenic
923384343 1:233451749-233451771 GAAGGTCAGGGGATGGAGGTGGG + Intergenic
923978619 1:239294728-239294750 AAAGGTAATGAGCTGGAGGTGGG - Intergenic
924918482 1:248599845-248599867 GAGGGTATTGGGATGCAGGCTGG - Intergenic
1064551628 10:16507085-16507107 GAGGGTCATGGGATCCAAGTTGG + Intronic
1064712574 10:18141313-18141335 GAGGATGATGGGGTGCAGGTGGG + Intronic
1064753982 10:18558418-18558440 GAATGTAATGGAATGGAGGATGG + Intronic
1064754004 10:18558578-18558600 GAATGTAATGAAATGGAGGTTGG + Intronic
1064755561 10:18569450-18569472 GAAAGGAATGGAATGGAGGTTGG - Intronic
1064755590 10:18569613-18569635 GAATGTAATGGAATGGAGGTTGG - Intronic
1064755725 10:18570526-18570548 GAGCGGAATGGAATGGAGGATGG - Intronic
1064755917 10:18571791-18571813 CAGTGTAATGGAATGGAGGATGG - Intronic
1065184637 10:23159781-23159803 GAGGTAACTGGGATTGAGGTGGG + Intergenic
1066004262 10:31132951-31132973 GAGGGGAATGGGCTGGGGGTGGG + Intergenic
1066545455 10:36495269-36495291 AAGGGTGATTGGATGAAGGTCGG + Intergenic
1068168341 10:53360072-53360094 TAGGGGATTGGGAGGGAGGTGGG - Intergenic
1069157027 10:65042299-65042321 AAGGGCATTGGGATGGTGGTGGG - Intergenic
1069694533 10:70376932-70376954 CAGGGCATTGGGAAGGAGGTAGG + Intronic
1069903322 10:71718348-71718370 GTGGGGAATGGGTGGGAGGTGGG - Intronic
1070160436 10:73863541-73863563 GAGAGTTATGGGCTGGAGGGTGG - Intronic
1070200306 10:74197930-74197952 GAGGGTAGAGGGATTGATGTGGG + Intronic
1070817134 10:79331695-79331717 GAGGGGAATAGGGAGGAGGTGGG - Intergenic
1071256823 10:83878781-83878803 GAGGTTACTGTGAAGGAGGTGGG - Intergenic
1071337234 10:84610660-84610682 GCAGGGAATGGGAAGGAGGTAGG + Intergenic
1071467214 10:85951939-85951961 TAGGGAGATGGGATGGAGGATGG - Intronic
1071588433 10:86847782-86847804 GAGGGCAATGGGGTGAAGGGTGG - Intronic
1071919028 10:90328836-90328858 GAGAATAATGGGAGGAAGGTGGG - Intergenic
1072350988 10:94556895-94556917 AAAGGTAATGGGATTGAGGGAGG - Intronic
1074186975 10:111106120-111106142 GGTGGCAGTGGGATGGAGGTGGG + Intergenic
1074477542 10:113786198-113786220 GAGAGAAATGGGATGGAGGTGGG - Intergenic
1074856877 10:117480378-117480400 GAGGTGATTGGGATGGTGGTGGG - Intergenic
1075685652 10:124363666-124363688 GAGGAAAATGGGAGGGAGGAGGG + Intergenic
1075968173 10:126630805-126630827 GATGGTAAGGGAATGGAGGGTGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076081618 10:127586777-127586799 CAGTGTCCTGGGATGGAGGTGGG + Intergenic
1077164083 11:1127316-1127338 GAGGGCACTGGGCTGGAGATGGG + Intergenic
1077353159 11:2102245-2102267 GTGGGTGAATGGATGGAGGTTGG + Intergenic
1078150809 11:8758276-8758298 GAAGCTAATGGGATGGGGGTAGG - Intronic
1078839008 11:15060306-15060328 GAGGGAAATAGGATGGAAGTTGG - Intronic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1079632393 11:22694012-22694034 GAGGGTAGCGGGAAGGAGGAGGG + Intronic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1080313904 11:30926451-30926473 GTGGAAAATGGGCTGGAGGTGGG + Intronic
1081394531 11:42569873-42569895 AAGGGTAAAGGGATGGAGAGTGG - Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1083690782 11:64407321-64407343 GAGCCTAATAGAATGGAGGTGGG - Intergenic
1083978823 11:66147718-66147740 GGGGGTAGTGGGAGGGAAGTGGG + Intronic
1084168569 11:67389267-67389289 GAGTGTAATGGGATGCTGGTGGG + Intronic
1084215657 11:67645638-67645660 GAGGGGAGTGGGAGGGAGGGAGG - Intronic
1085741746 11:79083168-79083190 GAGGCTGCTGGGGTGGAGGTGGG + Intronic
1086138428 11:83466740-83466762 GATGGCAATGGGATAGAGCTGGG + Exonic
1086144809 11:83540105-83540127 GATAGTAATGGGGTGGAGGAAGG - Intronic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088228521 11:107648275-107648297 GAAGGTAATGACATGGAGGAGGG - Intronic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088665110 11:112086516-112086538 GAGGGGAATGGGATGCAGCCGGG + Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089027529 11:115287358-115287380 GAGGGTGAGGGGACGGAGGCAGG + Intronic
1089430153 11:118416882-118416904 GAGGGTAAAGGGAAGCAGTTTGG + Intronic
1089670122 11:120050766-120050788 GAGGGCAATGGGAGAGAGGTGGG + Intergenic
1089685987 11:120147152-120147174 GAGAGGAATGGGAGGGAGGAAGG + Intronic
1089922923 11:122227952-122227974 TAGGTTTAAGGGATGGAGGTGGG - Intergenic
1091726195 12:2848315-2848337 GAGGGTGATGGGAAGGTGGCTGG - Intronic
1091992005 12:4962963-4962985 GAAGGTGATGGGAGGGAGGGGGG + Intergenic
1093410528 12:18860003-18860025 CAAGGGAATGGGATGGTGGTAGG - Intergenic
1094066226 12:26363444-26363466 GGGGGTGAGGGGGTGGAGGTGGG - Intronic
1094623154 12:32099455-32099477 TGGGGTAATGGGGTGGAGGATGG + Intergenic
1095498510 12:42811183-42811205 GAGTGTAATGAGTTGGGGGTGGG + Intergenic
1095962463 12:47844232-47844254 CAGGGCAATGGGATGTTGGTGGG + Exonic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096693144 12:53333317-53333339 AAGGGTGGTGGGGTGGAGGTCGG - Intronic
1096732455 12:53625740-53625762 AAGGGTAATAGGAAGGAGGTAGG - Intronic
1096829022 12:54300431-54300453 CAGAGTAATGGAATGGAGTTGGG + Intronic
1096846321 12:54409016-54409038 GAGGGCATAGGGAAGGAGGTGGG + Intronic
1096865307 12:54559231-54559253 GGGGGTAAAGGGGTGGGGGTGGG - Intronic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1097296187 12:57965551-57965573 AAGGGTAGTGGGGTGGGGGTGGG + Intergenic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1098129510 12:67334571-67334593 AAGGGTAGTGGGATGGTGGTGGG - Intergenic
1098637319 12:72800537-72800559 GTGAGTATAGGGATGGAGGTTGG - Intergenic
1099844205 12:88008207-88008229 GAGGGTAGAGGGTTGGAGGAGGG - Intronic
1100021907 12:90079085-90079107 GAGGAAAATGGGATGGGGATTGG + Intergenic
1100156916 12:91810461-91810483 GAGGGTAGTGGGTGGGAGGATGG + Intergenic
1100260610 12:92929163-92929185 GAGGGGACCGGGAAGGAGGTCGG + Exonic
1100800093 12:98221852-98221874 GAGGGAATTGGGGTGAAGGTGGG - Intergenic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1101771286 12:107753960-107753982 GAGGGTAAGGTGGTGGAGGTAGG + Exonic
1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG + Intronic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103285714 12:119799632-119799654 GAGGGTAATGGGATCTTGATGGG - Intronic
1103321502 12:120095254-120095276 GGGGGTTATGGGGTGGGGGTGGG - Exonic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1103621606 12:122190371-122190393 GAGGGTACTGGCATGCAGGGAGG + Intronic
1103680064 12:122686424-122686446 GAGCGAAATGGAATGGAGGGAGG - Intergenic
1103743617 12:123107625-123107647 GAGAGTCATGGGGTGGAGGGAGG - Intronic
1103937837 12:124485953-124485975 GTGGGGAGTGGGAGGGAGGTGGG - Intronic
1104034249 12:125087535-125087557 GAGGGGAAAGGGAGGGAGGTCGG - Intronic
1105007300 12:132729450-132729472 GAGGGGAATGGGAGGGTGGGAGG + Intronic
1105209546 13:18249813-18249835 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1105299458 13:19119011-19119033 GAGGGTGATGGGGGGGAAGTGGG + Intergenic
1105957267 13:25295688-25295710 GATGACAGTGGGATGGAGGTGGG + Intergenic
1106263666 13:28090962-28090984 GACAGTACTGGGATGGGGGTGGG + Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107449851 13:40498458-40498480 GTGGGGAATGGCATGGAGGTAGG - Intergenic
1108534110 13:51355529-51355551 GAAGGTATTGGGAAGGAGGGAGG - Intronic
1109259570 13:60128051-60128073 GAGGGTGATGGGTGGGAGGAGGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111711500 13:91820476-91820498 CAGAGTAGTGGGATGGTGGTGGG - Intronic
1112180423 13:97073549-97073571 TAGGGAAATGGGATGGAGAGAGG - Intergenic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1113428470 13:110229584-110229606 CAAGGTGATGGCATGGAGGTGGG + Intronic
1114613225 14:24055415-24055437 GATGGGGATGGGATGGAGTTGGG - Intronic
1115070233 14:29313410-29313432 GGGGGAAATGGGATGGAATTAGG - Intergenic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1117749722 14:58908625-58908647 AAGGGTGAGGGGATGGAGGAGGG + Intergenic
1117885388 14:60355910-60355932 AAGGGTACTGGGATAGAGTTTGG - Intergenic
1118617468 14:67584206-67584228 GTGGTTACTGGTATGGAGGTAGG - Intronic
1118659557 14:67993329-67993351 GAGTGTAGCGGGATGGAGGGAGG - Intronic
1118992982 14:70812337-70812359 GAGGGGAATGGGGTGGAGCAGGG + Intergenic
1120694884 14:87633457-87633479 AAGTGGAATGGGATGGTGGTGGG + Intergenic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1121343463 14:93118330-93118352 GAGGGAAATGGGAAGGAAGATGG + Intergenic
1122142962 14:99673636-99673658 GAGGGGGATGGCATGGAGGGGGG + Intronic
1122340400 14:101024445-101024467 AAGGGTTCTGGGATGGAGATAGG - Intergenic
1123739484 15:23222649-23222671 GAAAGTAATGGGATTGGGGTTGG + Intergenic
1124290703 15:28451609-28451631 GAAAGTAATGGGATTGGGGTTGG + Intergenic
1124292533 15:28465949-28465971 GAAAGTAATGGGATTGGGGTTGG - Intergenic
1124347778 15:28933968-28933990 GGGGGGCATGGGCTGGAGGTGGG + Intronic
1124377439 15:29137071-29137093 GGGGGTAATAGGGTGGAGGCGGG + Exonic
1125686026 15:41563875-41563897 GTGGGAGATGGGATGGAGGTGGG + Intronic
1125877136 15:43159368-43159390 GGGGGCATTGGGAGGGAGGTGGG - Intronic
1125986125 15:44054309-44054331 GAAGATAATAGGATAGAGGTTGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126370247 15:47938338-47938360 GGGGAAAATGGGATGGAGGTGGG + Intergenic
1126541436 15:49828866-49828888 GAGGGTGAAGGAATGCAGGTGGG - Intergenic
1126702155 15:51378093-51378115 GCAGGTAATGAGAGGGAGGTGGG - Intronic
1126982549 15:54260394-54260416 GAGGGTAATGGAGGTGAGGTAGG + Intronic
1127142336 15:55990731-55990753 GAGGTGCATGGGAAGGAGGTGGG + Intronic
1127865242 15:63027335-63027357 GAAAGTAATAGGATGGAGTTTGG - Intergenic
1128224003 15:65989181-65989203 GAGGATGCTGGGCTGGAGGTGGG + Intronic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1129359010 15:75012808-75012830 GAGTGCCATGGGATGGGGGTGGG + Intronic
1129667091 15:77585273-77585295 CAGGGTGGTGGGGTGGAGGTGGG + Intergenic
1129694585 15:77733427-77733449 AAGGGTCATGGCATGGGGGTGGG - Intronic
1129934900 15:79439348-79439370 GTGGGTAATGAGATGTGGGTGGG + Intronic
1130159695 15:81386295-81386317 GAGGAGAATGGGATGTAGCTGGG - Intergenic
1131161295 15:90106653-90106675 GAGGGTATTGGGATAGAGCCTGG + Intergenic
1131671106 15:94620303-94620325 GAAGGAAGTGGGGTGGAGGTGGG + Intergenic
1131788560 15:95939238-95939260 AAGGGCAATGGGATGGAGCTAGG + Intergenic
1132855496 16:2042905-2042927 GAGGGGAATGGTAGGGAGGGAGG - Intronic
1133303077 16:4795059-4795081 AAGGGTCGTGGGATGCAGGTAGG + Exonic
1133338542 16:5022089-5022111 GAGGGTGTTGGGGTGGGGGTGGG - Intergenic
1134358242 16:13504919-13504941 TAGGGCAGTGGGATGGAAGTGGG - Intergenic
1135156434 16:20056985-20057007 GAGGGTAATGGGGATGATGTCGG + Intronic
1136006863 16:27336740-27336762 GAGAGAAAAGGCATGGAGGTGGG + Intronic
1136170723 16:28487631-28487653 GAGGGTAGTGGGAGGCAGGGTGG - Intronic
1136690513 16:32025071-32025093 GAGAGTAATGGAGTGGAGGGAGG + Intergenic
1136791100 16:32968631-32968653 GAGAGTAATGGAGTGGAGGGAGG + Intergenic
1136878714 16:33885301-33885323 GAGAGTAATGGAGTGGAGGGAGG - Intergenic
1137962055 16:52891508-52891530 GAGGGTATTGGCTTGGGGGTTGG + Intergenic
1138218543 16:55227403-55227425 GAAAGGAATAGGATGGAGGTAGG - Intergenic
1138249124 16:55488985-55489007 GAGAGAAAAGGGATGCAGGTCGG - Intronic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139228486 16:65256806-65256828 GAGTGAATGGGGATGGAGGTTGG + Intergenic
1140037531 16:71382647-71382669 AAGGGGAATGGAAGGGAGGTGGG + Intronic
1140358146 16:74323262-74323284 GAGGGGCATGGGATGGGGGTAGG - Intergenic
1140406486 16:74714530-74714552 AAGGGGAAGGAGATGGAGGTGGG - Intronic
1140512564 16:75518439-75518461 GACCGGAATGGGAGGGAGGTTGG + Intergenic
1140914651 16:79483042-79483064 GAGGAGGATGGGATGGAGGGAGG - Intergenic
1141162785 16:81640202-81640224 TCGGGTAATGGGCTGGAGGCGGG + Intronic
1141348711 16:83273326-83273348 GAGGGTGAAGGGTTGGGGGTGGG - Intronic
1141377509 16:83545550-83545572 AAGGGTAATGGACTGGAGGCTGG - Intronic
1141423243 16:83930679-83930701 ACGGGAAATGGGATGGAGGCAGG + Intronic
1203093308 16_KI270728v1_random:1230092-1230114 GAGAGTAATGGAGTGGAGGGAGG + Intergenic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142969491 17:3601491-3601513 TGGGGTACTGGGATGGAGGAGGG - Intergenic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1144422306 17:15109800-15109822 GAGGGGAATGGGGTGAGGGTGGG - Intergenic
1145887712 17:28394307-28394329 GGTGGTAGTGGGGTGGAGGTAGG + Intronic
1145888059 17:28396436-28396458 GAGGAAAGTGGGTTGGAGGTGGG - Exonic
1146430387 17:32787741-32787763 GAGGGGAAAGGGAGGGAGGTGGG - Intronic
1147153372 17:38531207-38531229 GAGAGTAATGGAGTGGAGGGAGG + Exonic
1147438529 17:40432473-40432495 GAGGGCAATGGACTGGAGGATGG - Intergenic
1147745785 17:42693574-42693596 GGGTGTAATGGGATGTAGGGAGG + Intronic
1148134919 17:45286065-45286087 GAGGAAAAAGGGAAGGAGGTGGG + Intronic
1148794074 17:50188869-50188891 GAGGGTACTGGCATGGGGGCTGG + Intronic
1148869243 17:50646337-50646359 GAGGGTCATGGGTTGGGGGAAGG + Intronic
1149197631 17:54140805-54140827 TAGGTAAATGGGATGGAGTTGGG - Intergenic
1149500544 17:57149188-57149210 GAGGGTAATGTGGAGGAGATGGG - Intergenic
1150245059 17:63668529-63668551 GAGATTGAGGGGATGGAGGTGGG + Intronic
1150505053 17:65690469-65690491 GATTATAATGGGGTGGAGGTAGG + Intronic
1151091458 17:71444617-71444639 GGGTGTAATGTCATGGAGGTAGG - Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151259810 17:72907685-72907707 GAGTGGAGTGGGATGGAGGTGGG - Intronic
1151452955 17:74210539-74210561 CAGGGTACTGGGATGGGGGGAGG + Exonic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1153324902 18:3808672-3808694 GAGGGGGATGGGATGAAGATTGG - Intronic
1153795893 18:8621762-8621784 GAGGGTGATGGGTAGGAGGAAGG - Intronic
1153829685 18:8911212-8911234 GAGGGCTTTGGGATGGAGGGAGG + Intergenic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1156198997 18:34808725-34808747 GAGGGTGATGGGATGGGGTGAGG - Intronic
1157432903 18:47644208-47644230 GAGGGTGAAGGGAAGGTGGTTGG + Intergenic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157604832 18:48919533-48919555 TAGGGTAATGGGAAGGAGACAGG - Intergenic
1158257834 18:55573097-55573119 GAGGGTACAGGGGTGGAAGTGGG - Intronic
1159586233 18:70286272-70286294 GGGCGTAGTGGCATGGAGGTGGG - Intergenic
1159622171 18:70651125-70651147 GATGGCAGTGGGATGGAGATGGG + Intergenic
1160122977 18:76146983-76147005 GAGGGTAATGGGATGAGGAAGGG + Intergenic
1161072552 19:2270009-2270031 GAGGGGCATGGGTCGGAGGTCGG + Intronic
1161696132 19:5769315-5769337 GAGGGTGGTGGGATGGGGGGAGG + Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1161978114 19:7617294-7617316 GAGAAGGATGGGATGGAGGTGGG - Intronic
1162012079 19:7823479-7823501 GAGGGGAGGGGGATGGAGGGGGG + Intergenic
1164432810 19:28202615-28202637 GAGGGTAGAGGGTTGGAGGAGGG + Intergenic
1164891067 19:31824057-31824079 CAGGATACTGGGATGGGGGTGGG + Intergenic
1165332817 19:35150798-35150820 GAGGGCAATGGGCGGGAGGAGGG + Intronic
1165438086 19:35807636-35807658 GCAGGTAAAGGGCTGGAGGTGGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166093134 19:40523163-40523185 GAGGGTAGTGGGATAGGGCTGGG + Intronic
1166413827 19:42577258-42577280 AAGTGTAATGGGAAGGAAGTAGG - Intergenic
1166763156 19:45237036-45237058 GAGGGAAATGGGTGGAAGGTGGG + Intronic
1166935673 19:46330942-46330964 AAGGATAAATGGATGGAGGTTGG + Intronic
1167357173 19:49011118-49011140 GCGGGTGGTGGGGTGGAGGTGGG + Intronic
1167435473 19:49476213-49476235 GAGGGACCTGGGATGGAGGTGGG + Intronic
1167583510 19:50359976-50359998 CGGGGTAATGGGATGCAGGAAGG + Intronic
1168409811 19:56132640-56132662 GAGAGTAAAGGGCTGGAAGTGGG + Intronic
1168632182 19:57965695-57965717 GAGTGTAATGGTATGGATCTTGG - Intronic
925360829 2:3278872-3278894 GAGGCTAATGGGCTGGCGGGAGG - Intronic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
927035255 2:19167691-19167713 GTGGAGAATGGGATGAAGGTAGG + Intergenic
927787217 2:25982266-25982288 GAGGAAAATGGGATGGGGGTGGG + Exonic
927840463 2:26438806-26438828 GAGGGAGATGGGATGGAGGCTGG + Intronic
928251124 2:29681691-29681713 GAGGGAAGTGGGATGGGGCTGGG - Intronic
928402117 2:30986485-30986507 TGGGGTGATGGGATGGAAGTGGG + Intronic
928478045 2:31651649-31651671 GAGGGTGATGTGCTGCAGGTGGG - Intergenic
928601508 2:32908482-32908504 GATGGGAAGGGGATGTAGGTTGG - Intergenic
929458343 2:42082885-42082907 GAGGGGCCTGAGATGGAGGTGGG - Intergenic
929776084 2:44931828-44931850 CAGGGTATTGGGGTGGAGTTGGG + Intergenic
929936626 2:46298185-46298207 GAGGGAGATGGCCTGGAGGTCGG + Intronic
930090831 2:47530202-47530224 GAGGGCTGTGGGATGGAGGGCGG + Intronic
931927675 2:67091960-67091982 AAGGGTAGTGGGATAGGGGTAGG + Intergenic
932503385 2:72204786-72204808 GAGGGCAATGGGTTTGGGGTGGG + Intronic
932598952 2:73111382-73111404 GAGGGTAAGGGGATTGGGGCAGG - Intronic
933059751 2:77722898-77722920 GAGGGTGAAGGGTTGGAGGAGGG + Intergenic
934680178 2:96278068-96278090 GGTGGTAATGGGATGGAGATGGG + Intronic
935613189 2:105047476-105047498 GAAGGGAAGGGGATGGAGGTAGG + Intronic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
937328614 2:121007607-121007629 GAGGGCAATGGGATGAGGGAGGG - Intergenic
937757201 2:125554705-125554727 GAGGGTTGAGAGATGGAGGTGGG - Intergenic
938029960 2:127983586-127983608 AAGGGCACTGGGGTGGAGGTTGG + Intronic
938143306 2:128813325-128813347 GTGGGTCATGGGCAGGAGGTAGG - Intergenic
938993409 2:136652905-136652927 GAGGTTAAAGGGATGGACTTTGG + Intergenic
939762472 2:146199682-146199704 GTGGGTAATGAGATGGGGTTTGG - Intergenic
940296085 2:152126252-152126274 GTGGGTAATGTGCTGGAGGGTGG + Exonic
941409855 2:165141018-165141040 GAAAGGAATGGGATGGGGGTAGG + Intronic
942084527 2:172431535-172431557 GAAGGGAATGGGGTGGAGGCAGG - Intronic
942139242 2:172960810-172960832 CAAGGTAATGGGATGTAGGTGGG + Exonic
944718724 2:202402127-202402149 GAAGGGAATGAGGTGGAGGTGGG + Intronic
944821902 2:203440452-203440474 GAAGGGACTGGGATGGAGCTGGG + Exonic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945336926 2:208603462-208603484 AAGGGTAGTGGGAGGAAGGTGGG + Intronic
946221025 2:218227099-218227121 GAGGGTAAAGGGATGGTGCCTGG - Intronic
946409510 2:219509154-219509176 GAGGGGATTGAGATGGAGGTGGG - Intergenic
946729173 2:222691863-222691885 AAGAGGAATGGGTTGGAGGTGGG - Intronic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947817657 2:233048807-233048829 GGGGACAATGGGATGGAGGCGGG + Intergenic
1168734192 20:115952-115974 GACTGTAATGGGGTGGGGGTGGG - Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169023439 20:2347876-2347898 GTGGGCAGTGGGATGGAAGTGGG + Intergenic
1170126744 20:12972037-12972059 GAGGGTGAAGGGTTGGAGGAGGG - Intergenic
1171107108 20:22445040-22445062 GGTGGGAATGAGATGGAGGTAGG + Intergenic
1171290701 20:23981480-23981502 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1171981735 20:31633452-31633474 GAGGGCCATGGGGTGGAGGCCGG - Intergenic
1172054626 20:32145442-32145464 GAGGGAAAGGGGATGGGGGTTGG + Intronic
1172250498 20:33475965-33475987 GGGGGTATTGGGGTGGGGGTGGG - Intergenic
1172292207 20:33784327-33784349 GAGGGAGATGGGAAGGAGGAGGG - Intronic
1172995765 20:39069446-39069468 GAGGGTGGTGGGACTGAGGTGGG + Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173571868 20:44082223-44082245 TAGGGTAATGGGCTGGATCTTGG - Intergenic
1173760213 20:45553310-45553332 AAGGGTGGTGGGATGGGGGTGGG - Intronic
1174107332 20:48172000-48172022 GAGGAGAATGGGATGGGTGTGGG - Intergenic
1175124769 20:56742911-56742933 GGGGGTAAGGGCATGAAGGTGGG + Intergenic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175342998 20:58246705-58246727 GATGGAAGTGGGATGGAGGGAGG + Intergenic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1175676404 20:60949883-60949905 GGGGAGAAAGGGATGGAGGTAGG + Intergenic
1175934859 20:62509892-62509914 GAGGGCGAAGGGATGGAGGATGG - Intergenic
1176200613 20:63858635-63858657 GAGGGCACCGGGGTGGAGGTGGG + Intergenic
1176449568 21:6850757-6850779 GAAGGTCATGGAATGGAGCTGGG + Intergenic
1176827739 21:13715781-13715803 GAAGGTCATGGAATGGAGCTGGG + Intergenic
1178182004 21:30172135-30172157 GTGGGTGATGGACTGGAGGTGGG + Intergenic
1178384609 21:32138912-32138934 GTTGGTGATGGGTTGGAGGTGGG + Intergenic
1178514664 21:33236498-33236520 GAGGGTGACTGGCTGGAGGTTGG - Intronic
1178714819 21:34954599-34954621 GTGGTTAATGGGATGTAAGTGGG + Intronic
1180766720 22:18349587-18349609 GAGGGTTAGGGGATAGAGATGGG + Intergenic
1180779594 22:18512791-18512813 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1180812309 22:18770112-18770134 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1181041344 22:20194104-20194126 GAAGGTCATGAGATGGTGGTGGG - Intergenic
1181198466 22:21204359-21204381 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1181648264 22:24245451-24245473 GAGGGTTAGGGGATAGAGATGGG - Intergenic
1181703240 22:24632522-24632544 GAGGGTTAGGGGATAGAGATGGG + Intergenic
1182339656 22:29609143-29609165 CAGGAGAATGGGATGAAGGTTGG + Intronic
1182455260 22:30446380-30446402 AAGGGAAATGGGATGGGGGGCGG - Intergenic
1182567954 22:31213414-31213436 GAGGGTATTGAGGTGGAGGGGGG + Intronic
1182656746 22:31896751-31896773 GAGAGAAATGTGATGGAGGAGGG - Intronic
1182819563 22:33203596-33203618 GAGGGAAATGAGATGAAGCTAGG + Intronic
1183110508 22:35645361-35645383 GAAGGAGATGGGATGGAAGTGGG + Intergenic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184671173 22:46012990-46013012 GAGGGCAAGGGGGTGGAGATGGG - Intergenic
1185202465 22:49516662-49516684 GAGGGGAATGGGAGGGAGAGAGG + Intronic
1203228339 22_KI270731v1_random:90478-90500 GAGGGTTAGGGGATAGAGATGGG + Intergenic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
951167946 3:19505304-19505326 GAGGGTGAAGGGTTGGAGGAGGG + Intronic
952125115 3:30290953-30290975 GGGGGTCATGGGAGGGAGGGAGG - Intergenic
952535687 3:34306620-34306642 GAGGGTGAAGGGTAGGAGGTGGG - Intergenic
953144841 3:40265514-40265536 GATGGGAATGGGATGTGGGTGGG - Intergenic
953809649 3:46101062-46101084 GATGGAAATGGGGTGGAGCTGGG - Intergenic
954121725 3:48503840-48503862 GAGGGTGCTGGGGTGGAGGAGGG + Intronic
954447032 3:50552394-50552416 GATGCTAGTGGGATGGAGGCTGG - Intergenic
955484311 3:59420235-59420257 GAGAGGAATGGGATGGATATAGG - Intergenic
955496660 3:59540636-59540658 GAGGGTAAAGGGAGGAAGGAAGG + Intergenic
955932903 3:64075831-64075853 AAGGGTAGGGGGAGGGAGGTGGG - Intergenic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956290069 3:67651856-67651878 CAGGGTCATGGGATGGAGAATGG - Intronic
956433289 3:69208658-69208680 GACAGTAATGGGATGCAGGGAGG - Intronic
957734240 3:84186836-84186858 AAGCGTAATGGGATACAGGTTGG - Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958636989 3:96757670-96757692 GGGGGTTTTGGGTTGGAGGTGGG - Intergenic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959330365 3:104997003-104997025 GAGGGTAGGGTGGTGGAGGTCGG - Intergenic
959871661 3:111335739-111335761 GAGATGAAAGGGATGGAGGTTGG - Intronic
960400409 3:117190878-117190900 GAGGGTAGAGGGTTGGAGGAGGG + Intergenic
960590895 3:119364223-119364245 GGGGGTGGGGGGATGGAGGTGGG + Intronic
960944845 3:122958785-122958807 GAGGGCAAGGGGGTGGGGGTAGG - Intronic
961981514 3:131084136-131084158 GAGGGGATTGGGATTGGGGTGGG - Intronic
962415027 3:135174096-135174118 GTGGGGAAGGGGCTGGAGGTTGG - Intronic
962929345 3:140022675-140022697 GTGGAGAATGGGATGGAGGTGGG + Intronic
963306416 3:143658654-143658676 GAAGTCAAAGGGATGGAGGTGGG - Intronic
963450424 3:145474210-145474232 GAGAGGGATGGGAAGGAGGTGGG + Intergenic
963945577 3:151142538-151142560 GAGGGGTCTGGGATAGAGGTAGG - Intronic
963963121 3:151332886-151332908 GAGGGTAGTGGGTGGGAGGAGGG - Intronic
964499659 3:157334822-157334844 TTGGGTAAAGGCATGGAGGTGGG + Intronic
965110955 3:164421612-164421634 GAGGGTAATGGGATTAGGATAGG - Intergenic
965774581 3:172215302-172215324 CAGGCAAATGGGATGGAAGTGGG + Intronic
965863692 3:173178789-173178811 GAAGGTAAAGGGAAAGAGGTTGG - Intergenic
966664940 3:182461498-182461520 TAGAGTAATTGAATGGAGGTTGG - Intergenic
966961382 3:184943031-184943053 GAACGGAATGGGGTGGAGGTAGG - Intronic
967014918 3:185473197-185473219 AAGGGTATTGGGATTGAGCTTGG - Exonic
967603311 3:191414907-191414929 GAGGGTAATAGGATGACAGTAGG - Intergenic
967961367 3:194927926-194927948 GAGGGCAGTGAGATGGAGGAGGG - Intergenic
968761786 4:2446082-2446104 GAGGGGAAGGGGATGGTGCTGGG + Intronic
969208236 4:5665046-5665068 GTGGGTAATGGGATGCATGTGGG + Intronic
969942977 4:10753455-10753477 GAGGGAAAGGCAATGGAGGTGGG - Intergenic
970996615 4:22274868-22274890 GAGGGGAAAGGGTGGGAGGTGGG + Intergenic
972428062 4:38953764-38953786 CAAGGCAATGGGATGGAGGAAGG - Intergenic
972828175 4:42785879-42785901 AAGCGTAATGGCATGTAGGTAGG + Intergenic
974139887 4:57872557-57872579 GAGTGTAATAGGATGAAGATGGG - Intergenic
974597003 4:64027245-64027267 GATGGGAATGAGAAGGAGGTGGG - Intergenic
974797379 4:66770353-66770375 GAGGGTAGAGGGCAGGAGGTGGG - Intergenic
975445793 4:74463734-74463756 GATGAGAATGGGATGGAGGAGGG + Intergenic
977330547 4:95631993-95632015 GAGATTAAGGGAATGGAGGTGGG - Intergenic
978092780 4:104738314-104738336 GAGGGTAGTGGGTCGGAGGTGGG + Intergenic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
980938970 4:139254669-139254691 GGGGGTATTGGCAGGGAGGTGGG - Intergenic
981092269 4:140744107-140744129 AATAATAATGGGATGGAGGTGGG + Intronic
981514151 4:145588588-145588610 GATGGAATTGGGAGGGAGGTGGG + Intergenic
982285697 4:153731801-153731823 GAGGGTGGTGGGATGGTGGAGGG + Intronic
982534466 4:156592502-156592524 GAGGGGAAGGTGATGGAGATAGG - Intergenic
985966750 5:3343611-3343633 GTGGGTGGTGGGATGGAGGAGGG - Intergenic
986241703 5:5965642-5965664 GAGGGTAAGGGGACGGAGAGTGG - Intergenic
987260946 5:16202424-16202446 GAGGGTGAGGGGTTGGAGGAGGG + Intergenic
987429866 5:17819738-17819760 GCAGGTAATGGGAAAGAGGTGGG - Intergenic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989710039 5:44387809-44387831 TGGGGTAAAGGGATGGGGGTGGG + Intronic
990593574 5:57291141-57291163 AAGGGTAGTGGGATGGGGGAGGG + Intergenic
990828949 5:59934797-59934819 GAGTGAAATGGCATGGAGGTTGG + Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991227147 5:64286100-64286122 GAGGGTAAGTGTATGGAGGGAGG - Intronic
991256058 5:64616279-64616301 GTGGGTATTAGGATGGAGGTAGG - Intergenic
991630868 5:68655308-68655330 GAAGCTATAGGGATGGAGGTGGG + Intergenic
991900306 5:71454003-71454025 GAAAGTAATGGGAGGGAGGCTGG - Intergenic
992091782 5:73323950-73323972 AAGGGTAGTGGGGTGGGGGTAGG + Intergenic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
993026914 5:82657648-82657670 AAGGGCCATGGGAGGGAGGTTGG - Intergenic
993696697 5:91070104-91070126 GATGGGAAAGGGATGGAGGGGGG + Intronic
994085300 5:95751678-95751700 GAGGGTGGTGGGAGGGAGGAGGG - Intronic
995211515 5:109544901-109544923 GAGGGTAGTGGGTGGGAGGAGGG - Intergenic
995369135 5:111398981-111399003 GAGGGGAATGGAGTGGAAGTAGG - Intronic
995755827 5:115502996-115503018 CAGTGTAAGGGGATGTAGGTAGG - Intergenic
996089366 5:119335879-119335901 GGGGGTGAGGGGGTGGAGGTGGG + Intronic
996471282 5:123863932-123863954 GCAGCTAATGGGATGGAGCTGGG - Intergenic
997781299 5:136661515-136661537 GAAGATAAGGGGGTGGAGGTGGG - Intergenic
997904386 5:137800843-137800865 GAGGGTAGTGGGTAGGAGGAGGG - Intergenic
998164830 5:139837020-139837042 GAGGGGCATGGGAGGGAGGCTGG + Intronic
998738469 5:145170833-145170855 GAGGGTATAGGGAGGGAGGTGGG - Intergenic
999096109 5:148979400-148979422 GTGGGGAGTAGGATGGAGGTGGG - Intronic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000125281 5:158237647-158237669 GCTGGGAATGGGATGAAGGTAGG + Intergenic
1000194325 5:158943043-158943065 GAGGGAAGTGGGAGGGAGGGAGG + Intronic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1001054431 5:168437212-168437234 GAGGGTAATGGGATTTATATAGG - Intronic
1001172426 5:169433120-169433142 GTGGGTAATTGGGTGGAGATGGG - Intergenic
1002081787 5:176741712-176741734 GAGGGAAGTGGGCTGGAGATCGG + Intergenic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1003228488 6:4227878-4227900 AAGGGTAGTGGGAAGGAGGGAGG + Intergenic
1004525697 6:16405392-16405414 GAGTGGAATGGGAAGGAGATAGG - Intronic
1005480419 6:26250057-26250079 GAGGGTTAGGGGATGGGGGCAGG - Intergenic
1006231588 6:32592239-32592261 GAGAGTAATAGAATGGAGTTAGG - Intergenic
1006447812 6:34089804-34089826 GAGAGGCATGGGATGGGGGTGGG - Intronic
1006829199 6:36958610-36958632 GAGGGTAAAGGCATGGGGGCTGG + Intronic
1006997737 6:38277934-38277956 GAGGGTCATGGTAAGGGGGTTGG - Intronic
1007161636 6:39795915-39795937 GAGGGGAAAGGTAGGGAGGTGGG + Intronic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007636597 6:43303536-43303558 GGGGTGAATGGGATGGGGGTGGG - Intronic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008147764 6:47912266-47912288 GTGGGGGATGGGATGGGGGTGGG - Intronic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1011983643 6:93417415-93417437 GGGGGTGATGGGAGGGAGGGTGG - Intronic
1012029834 6:94044886-94044908 GAGGGTAGGGGAATGGAGGAGGG + Intergenic
1012335321 6:98048087-98048109 GATGGGAATGGTATGGGGGTGGG + Intergenic
1012985229 6:105868400-105868422 AAGGGAATTGGGATGGGGGTTGG + Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1015214235 6:130731677-130731699 GAGGGAAATGGGATGGAACCTGG - Intergenic
1015316647 6:131824389-131824411 GAGTGTAATGGGGATGAGGTGGG + Intronic
1015436505 6:133195783-133195805 GAGGGTGATGGGTGGGAGGAGGG - Intergenic
1015517580 6:134099325-134099347 GAGTGTAATGGGATGGAGTGAGG - Intergenic
1015640714 6:135328557-135328579 GGGGGTAAGAGGGTGGAGGTTGG - Intronic
1015772488 6:136783572-136783594 GTGGGAAATGTGGTGGAGGTGGG - Intronic
1016301486 6:142636506-142636528 GAAGGAAAGGGGATGGAGATGGG - Intergenic
1016458976 6:144262219-144262241 GATGGGAATGGGGTGGAGGTAGG + Intergenic
1017296252 6:152798140-152798162 AAGGGAAATGGGAGTGAGGTTGG + Intergenic
1019651776 7:2163281-2163303 GGGCGTAATGGGATGGAACTAGG + Intronic
1020068505 7:5209645-5209667 AACTGTGATGGGATGGAGGTGGG - Intronic
1020856197 7:13427396-13427418 GAGGGAAGTGGGAAGGAGGGAGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022446147 7:30472297-30472319 GAGGTGAATGGGAAGGATGTGGG - Intronic
1023486383 7:40691811-40691833 GAGAGGAATGGCATGGAGTTTGG + Intronic
1023687336 7:42749812-42749834 AAGGGTATTGGGGTGGGGGTTGG + Intergenic
1024640644 7:51325845-51325867 TAAGGTAATGGGATAGAGGCAGG + Intergenic
1024673681 7:51619212-51619234 GAGGGTGAGGGGATGGAGAATGG + Intergenic
1024743964 7:52386054-52386076 GAGGGAAGGGGGATGGGGGTGGG + Intergenic
1026549023 7:71351288-71351310 GAGGGTGATGGAAGGGAGGTAGG + Intronic
1026670070 7:72382605-72382627 GAGGAGAAAGGGAGGGAGGTGGG - Intronic
1026988957 7:74572198-74572220 GAGGGTACTGGGGTGGACATGGG + Intronic
1027224208 7:76233936-76233958 CAGAGTGATGGGATGGGGGTGGG - Intronic
1027246814 7:76373250-76373272 GAGGGTTAGGGGGTGGAGGTGGG + Intergenic
1028265936 7:88725657-88725679 GAGGAGAATGTGATTGAGGTTGG + Intergenic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1030869191 7:114734386-114734408 GAGGATGATGGGGTGGGGGTAGG - Intergenic
1031317668 7:120275760-120275782 ATGGGAAATGGGATGGAGGTTGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032531817 7:132627178-132627200 GAAGGTGATGGGATGGGTGTTGG - Intronic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1033315118 7:140290759-140290781 TAGGGTAACGGGGTGGAGGAAGG + Intergenic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033490422 7:141837930-141837952 GAGGGTAAGGGGCTGGACTTTGG + Exonic
1033606271 7:142930317-142930339 GGATTTAATGGGATGGAGGTGGG - Intronic
1033629133 7:143139997-143140019 GAGGGCAGTGGGATGGAGAGAGG - Intergenic
1035407222 7:158607051-158607073 GAAGGTAAGGTGATGGAGGATGG + Intergenic
1036688432 8:10926575-10926597 GAGGGATATGGGAGGAAGGTTGG + Intronic
1037464591 8:19148125-19148147 GAGGCTAATGGGGTGAAGGTGGG - Intergenic
1037500832 8:19484062-19484084 GAGACTAATGGGGTGGAGGGAGG - Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037947532 8:22998960-22998982 GAGGGGGATGGGATGGAGGTGGG + Intronic
1038260348 8:25987743-25987765 GAGGGCATTGGAATGGGGGTGGG - Intronic
1039745848 8:40426033-40426055 GAGGGGATTGAGAGGGAGGTAGG - Intergenic
1040484212 8:47854937-47854959 GAGGGTGGTGGGAGGTAGGTAGG - Intronic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1043347787 8:79320132-79320154 TAAGGTGATGGAATGGAGGTGGG + Intergenic
1044352870 8:91186813-91186835 GAGGTGGATGGGATGGAGGATGG + Intronic
1044741143 8:95327726-95327748 GAGGGTCATGGGAAGGTTGTAGG + Intergenic
1044924680 8:97200345-97200367 GAAGGTAAGGGTATGGATGTGGG - Intergenic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046726295 8:117678248-117678270 GAGGGAGATGGGGTGGGGGTAGG + Intergenic
1047044586 8:121037933-121037955 AAGGGGAATGGGATACAGGTTGG - Intergenic
1047214153 8:122863374-122863396 TGGGGGACTGGGATGGAGGTGGG - Intronic
1047303778 8:123637052-123637074 GAGGGTGCTGGGATGTGGGTGGG - Intergenic
1047684494 8:127291074-127291096 ATGGGGAATGGGTTGGAGGTAGG - Intergenic
1048343283 8:133556865-133556887 GAGGGAAGTGGGAGGGAGGTTGG + Intronic
1048608341 8:135993866-135993888 AAGGGTAGTGGGAGGGAAGTAGG + Intergenic
1048816796 8:138341707-138341729 GAGGGCAATGGATTGGAGTTAGG - Intronic
1049573376 8:143379724-143379746 GAGGCTGCTGGGATGGTGGTCGG + Intronic
1050350868 9:4740725-4740747 GCGGGTTATGGGGTGGCGGTGGG - Intronic
1050811887 9:9758745-9758767 GGGAGTAGTGGGATGGGGGTTGG - Intronic
1051166000 9:14262540-14262562 GAGCGCAATGGGATTGTGGTGGG + Intronic
1052234472 9:26193260-26193282 GTAGGTAATGGAATGGAGGAAGG + Intergenic
1052879753 9:33594159-33594181 TAGGGTGATGGGAGGGTGGTGGG + Intergenic
1053056743 9:34997438-34997460 GGGGGGAGTGGGAGGGAGGTGGG + Exonic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053471467 9:38348563-38348585 GCAGGTGCTGGGATGGAGGTGGG + Intergenic
1053496228 9:38550070-38550092 TAGGGTGATGGGAGGGTGGTGGG - Intronic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054854677 9:69885667-69885689 GTGTTTAATGGGGTGGAGGTTGG + Intronic
1055281059 9:74675171-74675193 GGGGGCAATGGCATGGAGGTAGG + Intronic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055797061 9:79986168-79986190 AAGGGAAATAGGAGGGAGGTGGG + Intergenic
1056123491 9:83512411-83512433 GATGGTAATGTGATGGAGAGTGG + Intronic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056307904 9:85309021-85309043 GAGGGTGAAGGGTTGGAGGAGGG - Intergenic
1056591592 9:87969513-87969535 GAGGGCAAGGGGATGGATGAAGG - Intronic
1057406957 9:94781024-94781046 AAGGGTAATGGTTTGGATGTAGG + Intronic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059650532 9:116312144-116312166 GAAGGTAATGAGATAGGGGTAGG - Intronic
1059878815 9:118667299-118667321 GAGGCTGATGGGGTGGGGGTGGG - Intergenic
1060071885 9:120557362-120557384 GGAGGTTATGGGATGGGGGTGGG - Intronic
1060549902 9:124479961-124479983 GAGGGATATGGAATGGAGGGAGG - Intergenic
1060606731 9:124921542-124921564 GGGGAAAATGGGTTGGAGGTAGG + Intronic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061445127 9:130633319-130633341 GAGGGAAAGGGGATGGATGGTGG - Intronic
1061446025 9:130638629-130638651 GAGTGTCATCGGATGGAGCTGGG + Intergenic
1061491871 9:130949424-130949446 GTGGGTGATGGGCTGCAGGTGGG + Intergenic
1061491875 9:130949442-130949464 GTGGGTGATGGGCTGCAGGTAGG + Intergenic
1062060793 9:134494172-134494194 GATGGTGCTGGGATGGTGGTTGG + Intergenic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062265434 9:135684695-135684717 GAGGGTACTGGGATGCACTTCGG + Intergenic
1203519618 Un_GL000213v1:33760-33782 GAAGGTCATGGAATGGAGCTGGG - Intergenic
1186822133 X:13300313-13300335 CAGGGGATTGGGATGGGGGTGGG - Intergenic
1187240521 X:17508939-17508961 GAAGGTAAGGGGTTGGAGATAGG + Intronic
1187337482 X:18393833-18393855 GAGGGGGGTGGGATGGATGTGGG - Intergenic
1188737051 X:33729907-33729929 AAGGGTAATGGGATGGAGAGTGG - Intergenic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189461275 X:41244953-41244975 GAAGGGAATGGAATGGAGGATGG - Intergenic
1189497268 X:41520600-41520622 AATGGTGATGAGATGGAGGTAGG + Intronic
1189584435 X:42443688-42443710 GGGAGCAATGGGATGGAGGTTGG - Intergenic
1189874814 X:45424806-45424828 GGGGGGAAAGGGAGGGAGGTAGG + Intergenic
1190055367 X:47178404-47178426 GAGGGAAATGGGCTGGGGGTGGG - Intronic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1190708820 X:53050782-53050804 GAGGGTAGTGGAAGGGAGGCAGG + Intronic
1190935340 X:54994444-54994466 GAGGCAAAGGTGATGGAGGTAGG + Intronic
1191051890 X:56202570-56202592 GAGGATAATGGAGTGCAGGTGGG - Intergenic
1192016525 X:67337574-67337596 CAGGGAAATGGAGTGGAGGTAGG - Intergenic
1192603732 X:72491791-72491813 GAGAGGAAAGGGGTGGAGGTGGG - Intronic
1192914298 X:75636796-75636818 GAGGGTAGAGACATGGAGGTGGG + Intergenic
1193723079 X:85009785-85009807 GAGGGTAATGGGTGGGAGCAAGG - Intronic
1194682755 X:96873501-96873523 GAGGGTTGTGGGAAGGAGATGGG + Intronic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1195915268 X:109929183-109929205 GAGGAAAATTGGGTGGAGGTGGG + Intergenic
1197727232 X:129784427-129784449 CAGGGTAAGAGGCTGGAGGTGGG + Intronic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1199486887 X:148358079-148358101 GAGGGGCATGGGATCTAGGTAGG - Intergenic
1199708661 X:150452352-150452374 GAGAGTTATGTGGTGGAGGTGGG + Intronic
1199715564 X:150505326-150505348 TAGGGTGAAGGGATGGAGGGTGG - Intronic
1199821992 X:151458554-151458576 GAGGGTGATGGGTGGGAGGAGGG + Intergenic
1201105729 Y:10761971-10761993 GAGGGGAATGGAATGGAGTGTGG - Intergenic
1201136070 Y:10991077-10991099 GAGTGGAATGGGATGGAGTGAGG - Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1202244739 Y:22808506-22808528 GAGGCTACTGGCATGCAGGTAGG - Intergenic
1202397728 Y:24442252-24442274 GAGGCTACTGGCATGCAGGTAGG - Intergenic
1202473053 Y:25227835-25227857 GAGGCTACTGGCATGCAGGTAGG + Intergenic