ID: 1190116814

View in Genome Browser
Species Human (GRCh38)
Location X:47630544-47630566
Sequence GTGATTAGGAGGGAATAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190116798_1190116814 21 Left 1190116798 X:47630500-47630522 CCATTGTTCCATGGGCCCAGCTG 0: 1
1: 0
2: 1
3: 8
4: 190
Right 1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG No data
1190116806_1190116814 5 Left 1190116806 X:47630516-47630538 CCAGCTGGGGACAACACCAGGGT No data
Right 1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG No data
1190116804_1190116814 6 Left 1190116804 X:47630515-47630537 CCCAGCTGGGGACAACACCAGGG No data
Right 1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG No data
1190116802_1190116814 13 Left 1190116802 X:47630508-47630530 CCATGGGCCCAGCTGGGGACAAC No data
Right 1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190116814 Original CRISPR GTGATTAGGAGGGAATAAGC TGG Intergenic
No off target data available for this crispr