ID: 1190117981

View in Genome Browser
Species Human (GRCh38)
Location X:47638176-47638198
Sequence GGATGACCTGGTAGAGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190117978_1190117981 -8 Left 1190117978 X:47638161-47638183 CCTCGGGCGGGGTCAGGATGACC 0: 3
1: 0
2: 0
3: 7
4: 88
Right 1190117981 X:47638176-47638198 GGATGACCTGGTAGAGGAGCAGG 0: 1
1: 0
2: 3
3: 23
4: 256
1190117971_1190117981 10 Left 1190117971 X:47638143-47638165 CCGATTTCAGGTTTGGGGCCTCG 0: 2
1: 0
2: 2
3: 4
4: 77
Right 1190117981 X:47638176-47638198 GGATGACCTGGTAGAGGAGCAGG 0: 1
1: 0
2: 3
3: 23
4: 256
1190117966_1190117981 25 Left 1190117966 X:47638128-47638150 CCACATTAAGCTCTTCCGATTTC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1190117981 X:47638176-47638198 GGATGACCTGGTAGAGGAGCAGG 0: 1
1: 0
2: 3
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190117981 Original CRISPR GGATGACCTGGTAGAGGAGC AGG Exonic
900089169 1:912106-912128 GGAGGACCTGGAGGAGGCGCTGG - Intergenic
900408976 1:2504393-2504415 GGATGACATGCTGGAGGAGGAGG - Exonic
901806194 1:11740140-11740162 GTATGGCCTGAAAGAGGAGCTGG - Intronic
901843389 1:11967034-11967056 TGATGAGCTGGTGGAGGAGATGG + Exonic
902068148 1:13706423-13706445 TGATCACCTGTAAGAGGAGCCGG - Intronic
902234938 1:15051183-15051205 GAAGGACCTGGTAGAGGATTCGG + Intronic
902331299 1:15732334-15732356 GGATGACCTGGCAGCGGGGCAGG - Exonic
903829873 1:26168412-26168434 AGAAGACCTGGCAGAGGAGGTGG - Intergenic
904288972 1:29471533-29471555 GGATGAGCTGGCAGAGGGGCAGG - Intergenic
904331123 1:29758360-29758382 GGATGAGCTGGCAGAGGGGCAGG - Intergenic
905043258 1:34977203-34977225 GGTTGAACAGGTAGAGAAGCAGG + Intergenic
905278249 1:36833013-36833035 GTATATCCTGGCAGAGGAGCTGG - Intronic
905515487 1:38559004-38559026 GGATGGGCTGGGAGAGGACCAGG + Intergenic
905635476 1:39548483-39548505 GGATGGCCTGATGGAGAAGCAGG + Intergenic
906650550 1:47509396-47509418 GGAGGAGCTGGGAGAGGGGCAGG + Intergenic
907474319 1:54695409-54695431 GGATGAGCAGGTAGAGGATGCGG - Exonic
910713002 1:90201104-90201126 GGATCACCTGGCAGGGGAACAGG + Intergenic
911875880 1:103162677-103162699 GGATGAGCTGTTATAAGAGCAGG - Intergenic
912468538 1:109890757-109890779 GGAGGACATGAGAGAGGAGCAGG - Intergenic
912661255 1:111532848-111532870 GGATGAGCTGATAGCGGACCTGG + Intronic
912807756 1:112771326-112771348 AGACCACCTGGGAGAGGAGCGGG - Intergenic
915624529 1:157106582-157106604 CGATGACGTGGCAGAGGAGCAGG + Intergenic
915669767 1:157478783-157478805 GGATGACCTGGCATTGGAGAAGG + Intergenic
915770801 1:158420752-158420774 GAGTGAACAGGTAGAGGAGCAGG + Exonic
915774261 1:158465654-158465676 GAGTGAACAGGTAGAGGAGCAGG - Exonic
916571275 1:166029849-166029871 GCATGACCTGGAAGCAGAGCTGG + Intergenic
918117233 1:181507941-181507963 GGATGACATGGAAGAGGCCCTGG + Intronic
918423673 1:184387425-184387447 GGATGCCCGGGTAGCCGAGCCGG - Intronic
1065293691 10:24255389-24255411 GGACGAGCTGGTTGTGGAGCGGG + Intronic
1066298994 10:34080302-34080324 GTATGACCTGGCTGAGGAGAGGG - Intergenic
1066443362 10:35459690-35459712 GGCTGAGCTGGTGGAGGAGGTGG - Intronic
1068424673 10:56844827-56844849 GTTTGACCTGGTAAAGGAGTAGG - Intergenic
1068653718 10:59553323-59553345 GGATGGCCTGGCACAGGAGCTGG + Intergenic
1069576963 10:69537632-69537654 GGATGACGTCATAGTGGAGCAGG - Intergenic
1072766330 10:98097692-98097714 GGATCACCTGGCAGAGAAGAGGG - Intergenic
1073281024 10:102354264-102354286 GGATGACAGGGGAGAGGAGAAGG - Intronic
1073454458 10:103628248-103628270 TGAAGACCTGGGAGATGAGCTGG - Intronic
1073509183 10:104032721-104032743 GGATGACCTGGTGGCCCAGCAGG + Exonic
1075032699 10:119036215-119036237 AGATGACCGGGTGGAAGAGCGGG - Exonic
1075796037 10:125120262-125120284 GGATGAGCAGGAAGATGAGCAGG + Intronic
1076098438 10:127753562-127753584 GGCTGAGCTGGAAGAGGAGAAGG + Intergenic
1076108618 10:127844684-127844706 GGATGACCTGGTCCATCAGCGGG + Intergenic
1076614517 10:131746905-131746927 GGAGGAGCTGGAGGAGGAGCAGG - Intergenic
1077256381 11:1585267-1585289 GGTGGAGCAGGTAGAGGAGCAGG + Exonic
1077258122 11:1598268-1598290 GGTGGAGCAGGTAGAGGAGCAGG + Exonic
1077259531 11:1608403-1608425 GGTGGAGCAGGTAGAGGAGCAGG + Exonic
1077262393 11:1629801-1629823 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1077274428 11:1697206-1697228 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1077616954 11:3683018-3683040 GGATGAGGCGCTAGAGGAGCAGG - Intronic
1080749369 11:35138707-35138729 GGATATCCTGGGAGAGGAGCTGG - Intergenic
1081682697 11:45019364-45019386 GGATGTCCTGGGAGAGGAAAGGG + Intergenic
1083265632 11:61545687-61545709 GGATGACCTGGTGGCTGAGATGG + Intronic
1083948642 11:65941268-65941290 GGAGGAACTGGCAGAGGAGCTGG + Intergenic
1084182094 11:67451935-67451957 GGAAGGCCAGGTAGAGCAGCTGG + Exonic
1084185539 11:67469012-67469034 GGTTCACCTGGTAGCGCAGCCGG + Exonic
1084421247 11:69061699-69061721 GGATGGGCTGGGATAGGAGCAGG + Intronic
1084798741 11:71527261-71527283 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1084800079 11:71538016-71538038 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1084801747 11:71548618-71548640 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1084803839 11:71565548-71565570 GGTGGATCAGGTAGAGGAGCAGG - Exonic
1085201673 11:74705797-74705819 GGATGAGCTGGCAGAGGAGAAGG + Intronic
1085704977 11:78778782-78778804 GGATGACATGAGAGAGGAGAAGG + Intronic
1086173775 11:83865594-83865616 GGAGGAACCGGTAGAGGAGAAGG + Intronic
1086690368 11:89783566-89783588 AGATGATGGGGTAGAGGAGCAGG + Intergenic
1086715487 11:90056391-90056413 AGATGATGGGGTAGAGGAGCAGG - Intergenic
1086731617 11:90257056-90257078 GGTGGCCCTGGTAGAGGAGTGGG + Intergenic
1086811358 11:91314294-91314316 TCCTGACCTGGTAGAGGAGGTGG - Intergenic
1087381359 11:97408900-97408922 GGCTGACCTGGTACTGGAGTAGG - Intergenic
1089063220 11:115643043-115643065 GGCTGACCTGAGGGAGGAGCTGG + Intergenic
1089381075 11:118032500-118032522 TGATGATCTGGGAGAGGAACTGG + Intergenic
1090277660 11:125431284-125431306 GGATGAGATGGAAGAGGAGGAGG + Exonic
1090479199 11:127053178-127053200 GGTTGACCTGGCAGAGGATGAGG + Intergenic
1091302905 11:134518994-134519016 GGGGGATCTGGGAGAGGAGCAGG - Intergenic
1092131928 12:6118880-6118902 GGAGGAGCTGGAAGAGCAGCTGG - Intronic
1092259978 12:6947798-6947820 GGATGAGGAGGAAGAGGAGCTGG + Intronic
1093702333 12:22236119-22236141 GGGAGACGTGGTAAAGGAGCAGG - Intronic
1095619243 12:44229156-44229178 GGAAAAACTGGTGGAGGAGCAGG + Intronic
1101861606 12:108486692-108486714 GGAACATCTGGGAGAGGAGCAGG + Intergenic
1103567111 12:121822491-121822513 ACATGACCTGGAAGTGGAGCCGG + Exonic
1104915531 12:132262483-132262505 GGATGACCTCCTTGAGGAGCTGG + Intronic
1106784473 13:33093055-33093077 GGATGAGCTGATAGAGGGGATGG + Intergenic
1107673384 13:42769828-42769850 GGATGGCCTGGTGGGGGTGCTGG + Intergenic
1108436408 13:50405663-50405685 GGATGACATGGGTGAGGAGGAGG - Intronic
1110834969 13:80073190-80073212 AGATGAACTGGTAGAGGGGAAGG - Intergenic
1111545815 13:89734583-89734605 TGAGGACCTGGTAGAGTACCTGG + Intergenic
1112956112 13:105059990-105060012 GGGTGAGCTGGTAGAGGAGCCGG - Intergenic
1114479875 14:23026250-23026272 CTATGACCTGGAAGTGGAGCAGG - Exonic
1114676202 14:24442002-24442024 GGCTGACTGGGTGGAGGAGCAGG + Intronic
1118328161 14:64795516-64795538 GGAGGACCTGGCTCAGGAGCTGG - Exonic
1119220132 14:72899885-72899907 GGATGACCTGGAGGAGGAAAGGG + Intergenic
1119348125 14:73943087-73943109 GGGAAACCTGGGAGAGGAGCAGG - Intronic
1119782905 14:77289809-77289831 TGATGACATGGAAAAGGAGCTGG + Intronic
1121643408 14:95501374-95501396 GGGAGGCCTCGTAGAGGAGCTGG + Intergenic
1124618083 15:31256904-31256926 TGCTGCCCTGGTAGAGAAGCAGG - Intergenic
1126443848 15:48720074-48720096 GAATGACCTGGTAGAAGGGATGG + Intronic
1127122074 15:55780424-55780446 AGATGAGAGGGTAGAGGAGCGGG + Intergenic
1128599104 15:68980479-68980501 GAAGGGCCTGGGAGAGGAGCAGG + Intronic
1129151480 15:73691113-73691135 GGAAGACCAGGAAGAGAAGCAGG + Intronic
1130025547 15:80267794-80267816 GGATGACCTGCCCCAGGAGCCGG + Intergenic
1130647437 15:85741327-85741349 GCAGGACCTGGAAAAGGAGCGGG + Exonic
1130764656 15:86857737-86857759 GGATGTCCTGGTAAATGAGACGG - Intronic
1131059027 15:89393084-89393106 GCCTGACCTGGAAGAGGACCCGG + Intergenic
1131996826 15:98141443-98141465 AGATGACTTTGCAGAGGAGCAGG - Intergenic
1132045152 15:98557532-98557554 GGAAGGCCTGGCAGAGGAGAGGG + Intergenic
1133279098 16:4655134-4655156 GGCCGACATGGTGGAGGAGCTGG + Intronic
1133733670 16:8597370-8597392 GGATGCCCTGGTACAGGAGTGGG - Intergenic
1134402170 16:13920291-13920313 GGAGAAAGTGGTAGAGGAGCCGG - Exonic
1134625196 16:15718362-15718384 GGAGGAGCTGGAGGAGGAGCAGG - Exonic
1134625375 16:15719239-15719261 GGAGGAACTGGCAGAGGAGCTGG - Exonic
1134642185 16:15838066-15838088 GGATGAGGTGGTTGTGGAGCTGG - Exonic
1135161790 16:20102844-20102866 GGATAACAAGGTAGAGGAACAGG - Intergenic
1135569156 16:23535053-23535075 CCAGGGCCTGGTAGAGGAGCAGG + Exonic
1136606460 16:31337503-31337525 GGATGACCTGATAGAGAAATAGG + Intergenic
1137582465 16:49641648-49641670 GGATGAATTCATAGAGGAGCTGG - Intronic
1137953689 16:52807798-52807820 AGATTACCTGGTAGATGAGAGGG - Intergenic
1138741468 16:59315834-59315856 AGCTGTCCTGGAAGAGGAGCAGG + Intergenic
1139430172 16:66906963-66906985 GGATATCCTGGCAGAGGGGCAGG + Intergenic
1139431783 16:66914653-66914675 GGATGACCAGGATGAGGAGATGG + Intronic
1139533966 16:67560401-67560423 GGTTGACCTTGGAGAGGAACAGG - Intergenic
1140540047 16:75748710-75748732 GGATAATTTGGTAGAGGGGCAGG - Intronic
1141110950 16:81270311-81270333 GGTTGGCCAGGTAGAAGAGCTGG - Exonic
1142171566 16:88625252-88625274 GGATGACCTGGATCGGGAGCTGG - Exonic
1143714513 17:8757394-8757416 GGAGGAGCTGGAGGAGGAGCTGG - Exonic
1144965525 17:19075122-19075144 GGAAGAGTTGATAGAGGAGCAGG + Intergenic
1144982442 17:19177061-19177083 GGAAGAGTTGATAGAGGAGCAGG - Intergenic
1144985781 17:19201178-19201200 GGAAGAGTTGATAGAGGAGCAGG + Intergenic
1147481165 17:40764648-40764670 GGAGGTGCTGGGAGAGGAGCTGG + Intergenic
1147675645 17:42203266-42203288 GGAAGACCTGGTAGAGGAGAAGG + Intronic
1148092391 17:45030377-45030399 GGAAGACCTTGTAGAAGGGCTGG + Intronic
1148890057 17:50800725-50800747 GGAAGGCCGGGAAGAGGAGCTGG + Intergenic
1149727478 17:58910967-58910989 TGATGACCTGGTAGAGCTCCTGG + Intronic
1151194427 17:72421523-72421545 GGCTGACCTGGTAGATGGGTAGG - Intergenic
1151247164 17:72803790-72803812 GGATGGCCTTGAAGAGAAGCAGG + Intronic
1153353611 18:4109637-4109659 AGAGGACCTGGTTCAGGAGCAGG - Intronic
1153673449 18:7434648-7434670 GGCTTATCTGGTAGAGCAGCTGG + Intergenic
1154445308 18:14431119-14431141 GGAGGAGCTGGAAGAGGGGCCGG - Intergenic
1156377973 18:36531759-36531781 GGAAGACGTGGGACAGGAGCTGG - Intronic
1156791083 18:40975886-40975908 GGCTGACCAGGTAGGTGAGCAGG + Intergenic
1160443560 18:78911484-78911506 GGAGGCCCTGGGATAGGAGCTGG - Intergenic
1160443591 18:78911567-78911589 GGAGGCCCTGGGATAGGAGCTGG - Intergenic
1160774877 19:850811-850833 GGAGGAACTGGCAGGGGAGCTGG - Intergenic
1160969080 19:1759468-1759490 GGATGAGCAGGGAGAGGAGGAGG + Intronic
1162114730 19:8421975-8421997 GGATGACGGTGGAGAGGAGCCGG - Exonic
1163109619 19:15151710-15151732 GAAAGAGCTGGTGGAGGAGCTGG + Intergenic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1164414965 19:28039401-28039423 GGACCACATGGGAGAGGAGCAGG - Intergenic
1165682870 19:37792395-37792417 GGAGGCCCTGGAAGAGGAGGGGG + Intronic
925103944 2:1273032-1273054 GGGTCTCCTGTTAGAGGAGCCGG + Intronic
925580483 2:5405628-5405650 GACTGACCTGGGGGAGGAGCAGG + Intergenic
925785093 2:7424139-7424161 AAATGGCCTGGTAGAAGAGCAGG - Intergenic
927873848 2:26641260-26641282 GGAGGACCTGGAAGAGTACCAGG - Exonic
927886261 2:26720725-26720747 GGAAGAGCTGGGAGAGGAGATGG + Intronic
929766717 2:44849806-44849828 TGATGACCTGGGGGAGGGGCTGG + Intergenic
931939482 2:67236034-67236056 GGATTAGCTGGTAGAAGAGGTGG + Intergenic
932071516 2:68625378-68625400 GGATGATATGATAGAGAAGCTGG - Intronic
932598114 2:73106852-73106874 GGTTCACCTGGTAGTGGAGAAGG - Intronic
935944974 2:108277443-108277465 GGAGCAGCTGGAAGAGGAGCTGG - Intergenic
937976271 2:127583814-127583836 GGCAGGCCTGGTAGAGGACCCGG + Intronic
938272026 2:129980735-129980757 AGATGACATGGGAGAGTAGCAGG - Exonic
938443981 2:131363079-131363101 AGATGACATGGGAGAGTAGCAGG + Intergenic
940616731 2:156058137-156058159 GGATGAGCAGGGAGAGGAGGTGG - Intergenic
940859080 2:158753725-158753747 GGCTGACTTGGGAGAGGAGCCGG + Intergenic
942795942 2:179819385-179819407 GGATGATGTGGTAGAGGGGGAGG - Intronic
942950096 2:181712314-181712336 GGATGACCAGGCAGAGGGGGTGG + Intergenic
944381875 2:199119988-199120010 GAATCATCTGGTAGAGGATCTGG - Intergenic
945894007 2:215462237-215462259 GGATGAGCTGGGTGAGGAGTTGG + Intergenic
946513989 2:220391793-220391815 GGAGGACCAGGGAGAGGGGCAGG + Intergenic
948278198 2:236726116-236726138 GGATGACCTAACAGAGGAGTTGG + Intergenic
1169574615 20:6944108-6944130 GGATGACCTTAGAGAGAAGCAGG + Intergenic
1171304912 20:24096917-24096939 GGACGACCTGGAAGGGCAGCTGG - Intergenic
1172054229 20:32143026-32143048 GGAGGACATGGAAGAGGACCAGG + Exonic
1172446758 20:34997259-34997281 GGAGGAGCTGGAAGAGGAGCTGG + Exonic
1173003693 20:39123757-39123779 GGGTGACCTGGTTGAGGGGCAGG + Intergenic
1173727900 20:45309551-45309573 GGATGACCTGGGAGTAGGGCAGG - Exonic
1173958838 20:47055738-47055760 GGAAGACCTCTTAGAGGAGGTGG - Intronic
1174063383 20:47847545-47847567 TGAACACCTGGTAGAGGGGCTGG - Intergenic
1176450680 21:6858744-6858766 GGAGGAGCTGGAAGAGGGGCCGG + Intergenic
1176828850 21:13723762-13723784 GGAGGAGCTGGAAGAGGGGCCGG + Intergenic
1178918984 21:36726103-36726125 GGATGACCTGGGAGTGGAGAGGG - Exonic
1180193950 21:46182582-46182604 AGATGGCCTGGTAGATGAGGGGG - Intronic
1181270867 22:21657765-21657787 GGGTGGCCTGGAAGCGGAGCAGG - Intronic
1182243566 22:28936508-28936530 GGATGCCCTGGCAGAGCAGCAGG + Intronic
1183184787 22:36285705-36285727 GGAGGAGCTGGAGGAGGAGCAGG - Exonic
1183566177 22:38616872-38616894 GACTGACCTGGGAGGGGAGCAGG + Intronic
1184380160 22:44140380-44140402 GGGTGACCAGCTAGGGGAGCAGG + Intronic
1185329128 22:50244171-50244193 GGAGGAGCTTGTGGAGGAGCTGG - Exonic
949554821 3:5143780-5143802 GGATGACAGGGTAGAGGATATGG + Intronic
951133588 3:19076967-19076989 GAATGACGTTGAAGAGGAGCTGG - Intergenic
952835034 3:37595264-37595286 GTCTGACCTGGTGGTGGAGCTGG - Intronic
952903196 3:38122866-38122888 TGATGACATGGTATAGGAGTGGG - Exonic
953070374 3:39514335-39514357 GGATCATTTGGGAGAGGAGCTGG - Exonic
953224868 3:41009700-41009722 GGATGGCCTGGTACTGGAGCTGG + Intergenic
953497690 3:43402612-43402634 GGATGACCTGGGAAAAGACCAGG - Intronic
954031085 3:47820365-47820387 GGATGACCTGGTAGGGCAGTCGG + Intronic
955736373 3:62042657-62042679 GGAACACCTAGTAGAGGAACTGG - Intronic
957087474 3:75695042-75695064 GGATGAACGGATAGAGAAGCAGG + Intergenic
961371457 3:126434295-126434317 GGATGAGCTGCTAGAGAACCTGG + Exonic
961390079 3:126547321-126547343 GGAAGCCCTTGCAGAGGAGCGGG - Intronic
961483276 3:127197359-127197381 GGGTGACCGGGAGGAGGAGCGGG - Exonic
964419139 3:156482897-156482919 GGATAACCTGGTAGTAGACCTGG - Intronic
964767147 3:160190216-160190238 GGATGAACTGGTGGATGAACTGG + Intergenic
967793700 3:193575819-193575841 GGTTGACTTGGTAGAGAAGAAGG + Intronic
968533938 4:1112600-1112622 GGAGGACCTGGGGGAGAAGCGGG - Intronic
968581133 4:1395862-1395884 GGATGAGATGGAAGAGGAGAGGG + Exonic
969336930 4:6516497-6516519 GGATGGCCTGGTCCAGGAGCTGG - Intronic
969342980 4:6553873-6553895 GGGTGGCCTGGTAGAGAAGGGGG - Intronic
969595703 4:8148270-8148292 GGATGAGCTGGTGGATGAGAGGG + Intronic
974479942 4:62430206-62430228 GGGTGCCCTGGCGGAGGAGCAGG + Intergenic
975694612 4:76999367-76999389 GGACGGCCTCGTAGAGGAGGAGG + Intronic
976588947 4:86829902-86829924 TGATGGACTGATAGAGGAGCTGG + Intronic
977405857 4:96597722-96597744 GGATAACATGGGAGAGCAGCAGG + Intergenic
978644715 4:110916070-110916092 GGATGAGGTGGGAGAGGAGTGGG + Intergenic
978657946 4:111088782-111088804 TGAGGACCTGGTAGAGGTCCTGG - Intergenic
978977121 4:114891439-114891461 GGCTGATCTGGTGGAGGAGTTGG - Intronic
980522280 4:133949808-133949830 GGATGACAGGGTAGAGGATATGG + Intergenic
982860484 4:160442705-160442727 GGATGACCTGAAAAAGAAGCTGG - Intergenic
985475266 5:75340-75362 GGATGAGGTGGAAGAGGAGGAGG - Intergenic
985546307 5:510916-510938 GGAAGACCTGGTGGGGCAGCAGG - Intronic
986699441 5:10391640-10391662 GGATGACCAGGCAGAAGAGGAGG + Exonic
990368316 5:55092208-55092230 GGCTGCCTGGGTAGAGGAGCTGG - Intergenic
992376396 5:76192025-76192047 GCAAGACCTGCTAGATGAGCTGG - Intronic
992950155 5:81850707-81850729 GGATAACCTGGTGGTGGAGAGGG + Intergenic
994335356 5:98558648-98558670 GGATGGCCTGATAGAGGAAATGG - Intergenic
996655154 5:125926360-125926382 GGATGACAAGGTAGAGGATATGG - Intergenic
997593001 5:135086974-135086996 GGAGGTGCTGGTGGAGGAGCTGG + Intronic
1000021379 5:157322097-157322119 GCATGACCTGGTAGAGGTTGGGG - Intronic
1002642771 5:180638340-180638362 GGATGGGCTGGGAGAGGATCTGG - Intronic
1002644426 5:180646193-180646215 GGAGACCCTGGGAGAGGAGCAGG - Intronic
1004956188 6:20730515-20730537 AGATTACATGGTAGAGGAACAGG + Intronic
1005801166 6:29426816-29426838 AGAAGACCTTGGAGAGGAGCTGG + Exonic
1006153487 6:32001667-32001689 GCATGACCTGTAAGAGGAGCAGG - Intronic
1006159795 6:32034404-32034426 GCATGACCTGTAAGAGGAGCAGG - Intronic
1006254516 6:32819830-32819852 GGTTGACTTGGTAGGGGAGGAGG - Intronic
1006801374 6:36761895-36761917 GGAAGACCTCACAGAGGAGCAGG + Intronic
1007274939 6:40666382-40666404 GGGTGACCAGCTAGAGAAGCTGG + Intergenic
1012370782 6:98504143-98504165 GTATTACCTTGTAGAGCAGCTGG - Intergenic
1012905682 6:105062248-105062270 GGATGACTTTGTAAAGGAGTTGG - Intronic
1013078641 6:106793113-106793135 GCATGACCTGCTGGAGAAGCTGG - Intergenic
1016100019 6:140087702-140087724 GGAGTAGCTGGTAGAGGTGCTGG + Intergenic
1016648815 6:146440612-146440634 GGAAGCTCTGGTAGAAGAGCGGG + Intergenic
1017626208 6:156351706-156351728 GGAAGCCCTGGCAGAGGAGCTGG + Intergenic
1018038826 6:159904101-159904123 GGATGACCTGACAGAGAGGCAGG - Intergenic
1019571752 7:1716134-1716156 GGAACACGTGGAAGAGGAGCAGG - Intronic
1025943838 7:66091916-66091938 GGATGTCCTGGCAGAGGGGCAGG + Intronic
1028660130 7:93261781-93261803 GGAGGACCTGAACGAGGAGCAGG + Intronic
1029676211 7:102070817-102070839 GGATGACCTGGCAGGGGAGCGGG - Intronic
1030432617 7:109469962-109469984 GGAAAACCTGGTAGGGGAGTGGG - Intergenic
1032405889 7:131655106-131655128 GGATGACATGGCTGAGGAGGGGG + Intergenic
1033894421 7:146053802-146053824 GGATGACATAGTGGAGGAGATGG + Intergenic
1034378884 7:150671748-150671770 GGATGAGCTGATAAAGGAGGAGG + Intergenic
1034412563 7:150948921-150948943 GGACGACCTGCTGGAGGTGCTGG - Exonic
1035199090 7:157248559-157248581 CAATGACCTGGGAGAGGCGCAGG + Exonic
1037321900 8:17651655-17651677 GGATGGGCTGGCAGAGGAGGAGG - Intronic
1037815661 8:22110306-22110328 GGCCGAGCTGGGAGAGGAGCAGG - Intergenic
1037935521 8:22912769-22912791 GGATGACCTGGCTGGGGACCTGG + Intronic
1038577491 8:28717463-28717485 GCATGTCCTGGTAGGGAAGCTGG - Exonic
1047411849 8:124630395-124630417 GGAGGACCTGAAAGAGGAGGTGG + Intronic
1047603457 8:126450594-126450616 GGATGAGATGGGATAGGAGCGGG - Intergenic
1048612905 8:136043024-136043046 GGAGGACCAGGGAGAGGAGAAGG - Intergenic
1048872369 8:138810230-138810252 GGATGTCTTGGAAGAAGAGCAGG + Intronic
1049681946 8:143923013-143923035 GGAGGACCTGGCACAGCAGCGGG - Exonic
1051101917 9:13531612-13531634 GAAATACCTGGCAGAGGAGCAGG + Intergenic
1051355481 9:16236113-16236135 GGTTGACCTGGTAGATGAAGTGG + Intronic
1053105688 9:35406053-35406075 GGCTGGCTTGGGAGAGGAGCGGG - Intergenic
1053391628 9:37740384-37740406 GGTGGACCTGCTGGAGGAGCAGG - Exonic
1056719572 9:89060336-89060358 GGAGGACATGGTAGAGGACGTGG + Intronic
1061368221 9:130183420-130183442 GGATTCCCTGGCAGGGGAGCAGG + Intronic
1061913980 9:133739546-133739568 GGAGGACCTCTTAGAGGAGGGGG + Intronic
1061967543 9:134024919-134024941 GGAAGACGTGGAGGAGGAGCTGG - Intergenic
1062216553 9:135392596-135392618 GGTTGACCTGGGCGAGGACCTGG - Intergenic
1203791413 EBV:153723-153745 GGATGCCCGGGTAAAGGAGGCGG - Intergenic
1203518502 Un_GL000213v1:25773-25795 GGAGGAGCTGGAAGAGGGGCCGG - Intergenic
1190117981 X:47638176-47638198 GGATGACCTGGTAGAGGAGCAGG + Exonic
1190574897 X:51825453-51825475 GGTTGACTTCGTAGAGGAGAAGG + Intronic
1192225794 X:69226910-69226932 GGAGGACCTGGCAGGGGAGGGGG + Intergenic
1192350963 X:70355751-70355773 GGCAGAGCTGGGAGAGGAGCAGG + Intronic
1192782057 X:74304318-74304340 GGATGCCCTAGAGGAGGAGCTGG + Exonic
1194916627 X:99716894-99716916 GGTTGGCCTGGTAGTGGGGCAGG - Intergenic
1195577570 X:106468232-106468254 GGAGGAGCTGGGAGAGGAGGAGG - Intergenic
1195577575 X:106468250-106468272 GGAGGAACTGGGAGAGGAGGAGG - Intergenic
1200127661 X:153824277-153824299 GGATGACCTGGTCCAGAAGATGG + Intronic
1200133540 X:153863922-153863944 GGATGAGCAGGACGAGGAGCAGG + Exonic
1200954859 Y:8933231-8933253 GGATGAGATGGAAGAGGAGAAGG + Intergenic