ID: 1190118102

View in Genome Browser
Species Human (GRCh38)
Location X:47638889-47638911
Sequence CCTTACCTGCAGAGGCAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190118094_1190118102 22 Left 1190118094 X:47638844-47638866 CCCTCCTCTTTACTGCCTCCTCT 0: 1
1: 0
2: 8
3: 115
4: 1137
Right 1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
1190118095_1190118102 21 Left 1190118095 X:47638845-47638867 CCTCCTCTTTACTGCCTCCTCTT 0: 1
1: 0
2: 4
3: 97
4: 744
Right 1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
1190118096_1190118102 18 Left 1190118096 X:47638848-47638870 CCTCTTTACTGCCTCCTCTTACT 0: 1
1: 0
2: 1
3: 40
4: 482
Right 1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
1190118097_1190118102 7 Left 1190118097 X:47638859-47638881 CCTCCTCTTACTGAATTTCTATA 0: 1
1: 0
2: 1
3: 25
4: 272
Right 1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
1190118098_1190118102 4 Left 1190118098 X:47638862-47638884 CCTCTTACTGAATTTCTATATTC 0: 1
1: 0
2: 0
3: 33
4: 372
Right 1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190118102 Original CRISPR CCTTACCTGCAGAGGCAAGC CGG Exonic
901415530 1:9113532-9113554 CCTTCCCTACAGAGGCCAGTGGG - Intronic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
903936745 1:26900598-26900620 CCTTTCCCACAGAGGGAAGCCGG + Intronic
904482967 1:30805595-30805617 CCTTGGCTGCCGAGGCAAGGGGG - Intergenic
905317838 1:37094885-37094907 CCATCCCTGCAGAGTCATGCCGG - Intergenic
905733349 1:40311136-40311158 CCTTCCCTTCAGGGGCATGCGGG - Exonic
907970402 1:59375324-59375346 CCTTACCTTGAGATGCCAGCAGG - Intronic
916615638 1:166436186-166436208 CCTGACCTTTAGAGGCAAGGAGG - Intergenic
922569540 1:226625873-226625895 ACTTTCCTGCAGTGACAAGCAGG - Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1063621437 10:7652361-7652383 ACTGAGCTCCAGAGGCAAGCAGG + Intronic
1063959722 10:11297324-11297346 ACTGACCTGCAGAGGCCAGGCGG + Intronic
1066041894 10:31556896-31556918 CTCTACCTGCAAAGCCAAGCTGG + Intergenic
1066277547 10:33883839-33883861 CCTTAGGTGCAGAGCCAAGCAGG + Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1068938340 10:62657546-62657568 CCTAGCCTGCAGGGGCAAGGGGG - Intronic
1069031127 10:63597383-63597405 CCCTATCTGCAGAGCCAAACTGG - Intronic
1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG + Intergenic
1069638063 10:69937623-69937645 CCTTTCCTCCAGGGGGAAGCAGG + Exonic
1071268789 10:83987679-83987701 CCATAGCAGCAGAGTCAAGCTGG - Intergenic
1075094582 10:119462432-119462454 TCTTACCTGCAAATGGAAGCAGG + Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075695714 10:124433692-124433714 CCACACCTGCACAAGCAAGCTGG - Intergenic
1076380398 10:130021247-130021269 CCTAATCAGCAGAGGCCAGCCGG - Intergenic
1079202027 11:18384582-18384604 CCTGACCAGAAGAGGAAAGCAGG - Intergenic
1083170671 11:60922409-60922431 CCTTCCCTGGTGAGGCAGGCTGG - Exonic
1086116610 11:83257938-83257960 TCTTGGCTGCAAAGGCAAGCTGG - Intronic
1090704367 11:129323109-129323131 GCTGATCTGCAGAGGCACGCAGG + Intergenic
1090858863 11:130635188-130635210 GCTTCCCTGCAGAGTCAGGCAGG + Intergenic
1093758448 12:22878569-22878591 ACTTGCCTTCAGAGGCAAGTAGG + Intergenic
1094825308 12:34264831-34264853 CTTGACCTGCCTAGGCAAGCGGG + Intergenic
1095417352 12:41991118-41991140 CATTTACTGCAGAGGCAATCAGG - Intergenic
1095604742 12:44053152-44053174 CCTTCCCTTCAGATGCGAGCTGG + Intronic
1097260273 12:57715949-57715971 GCCTACGTTCAGAGGCAAGCCGG + Exonic
1102923717 12:116811257-116811279 CCCTACCTCCAGAGGTAAACAGG - Intronic
1103138067 12:118525026-118525048 CCTTTCCTGCTGGGGCAAACAGG + Intergenic
1103913633 12:124364972-124364994 CCATACCCGCAGACGCAGGCCGG - Intronic
1103920427 12:124396596-124396618 CCTGACCTGCAGCGGCAGGCAGG + Intronic
1104795197 12:131512270-131512292 CCCTCCCTGCAGAGGCCTGCTGG - Intergenic
1109433414 13:62267009-62267031 CCTTATCTGCAGAGGCCAAGTGG - Intergenic
1112616784 13:101014644-101014666 CTAGACCTGGAGAGGCAAGCTGG - Intergenic
1114567727 14:23644869-23644891 CATCAGCTGCAGAGGCAAGTGGG + Exonic
1119663235 14:76466026-76466048 CCTTGCCTGCAGAGCCAGGAGGG - Intronic
1120057392 14:79940623-79940645 CCTTACCTACAGAGGAACGAAGG - Intergenic
1120195150 14:81473632-81473654 CTTTACCTGCCAAGACAAGCAGG - Exonic
1122722427 14:103729830-103729852 GCTGACCTTCAGAGGCAGGCTGG - Exonic
1123051711 14:105547229-105547251 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123077125 14:105672932-105672954 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123998976 15:25738965-25738987 CAATACCTGCAGAGACAATCTGG + Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127583272 15:60357005-60357027 CCTTGCCTGCATAGTCAAGGTGG + Intronic
1128075333 15:64822260-64822282 ACTTACCTGCAAAGGCATGGAGG + Exonic
1131485713 15:92818753-92818775 ACTTCCCTGCAGAGGAAAGGTGG + Intergenic
1132408898 15:101561924-101561946 CCTCACCTTCATAGGCAATCAGG + Intergenic
1132621082 16:868594-868616 CCTGGCCTGGAGAGGCAAGAAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1136360962 16:29779488-29779510 CCTGAACTGGAGGGGCAAGCAGG - Exonic
1137486780 16:48897918-48897940 CCTGACCTGCAGAGCAAATCTGG - Intergenic
1138112000 16:54331089-54331111 CCTTACCTGGAGTGGCTAACTGG + Intergenic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1140867218 16:79073678-79073700 CTCTAGCTGCAAAGGCAAGCAGG - Intronic
1144148899 17:12424301-12424323 CCTACCCTGCAGAGGTCAGCTGG + Intergenic
1150209859 17:63436001-63436023 CCATACCTGAAGAGGCAGGCAGG + Intronic
1151542390 17:74771214-74771236 CTTGTCCTGCAGAGGCAGGCTGG - Exonic
1151890962 17:76950032-76950054 CCTGACCCGCTGAGGCAGGCGGG - Exonic
1151985426 17:77540332-77540354 CCTTACCTGCAGGGCCAGGGCGG + Intergenic
1152241591 17:79164003-79164025 GCCTGCCTGCAGAGGAAAGCAGG - Intronic
1152247530 17:79192927-79192949 CCTGACCCCCAGAGGGAAGCAGG + Intronic
1155054161 18:22170414-22170436 CCTTCCCAGCAGAGGCAATGCGG - Intronic
1155422204 18:25667589-25667611 CCTTAGGTGCAGATGCAGGCAGG - Intergenic
1156282873 18:35658150-35658172 CCTTTCCTCCAGAGGCAAGGAGG - Intronic
1157546127 18:48547687-48547709 CCCTTCCAGCAGAAGCAAGCAGG - Intronic
1160507735 18:79436811-79436833 CCTTTCCTTCAGAGGGAAGGAGG + Intronic
1163574864 19:18104721-18104743 ACTTAGGTGCAGAGGAAAGCCGG - Intronic
1165437829 19:35806396-35806418 TATTTCCTGCAGAGGCCAGCTGG + Intronic
1167514213 19:49913601-49913623 CTCTACCTGCAGAGGAGAGCTGG + Intronic
1168369259 19:55818171-55818193 CCTTCCCTGGAGAAGCAAGATGG - Exonic
925965982 2:9066672-9066694 CCAATCCTGCAGAGTCAAGCTGG + Intergenic
926155366 2:10450482-10450504 CCTTGCCTGGAGAGCCCAGCAGG + Intergenic
927743737 2:25596080-25596102 CCTTACCTGCTGTGGAAAACAGG + Exonic
928326018 2:30320143-30320165 CCTTACCTGCAGGGGAGAGTGGG - Intronic
929668442 2:43851674-43851696 CCTCACCAGCTGAGGCGAGCTGG - Exonic
931970484 2:67580198-67580220 ACTTACATGCATATGCAAGCGGG - Intergenic
933984705 2:87580962-87580984 ACTGTCCTGCAGAGGCTAGCAGG - Intergenic
934989194 2:98909670-98909692 CGTTCCCTGGAGAGGCCAGCTGG - Intronic
936309146 2:111369838-111369860 ACTCTCCTGCAGAGGCTAGCAGG + Intergenic
936506466 2:113111832-113111854 CCTTACTTGCAGAGGCAAAGAGG + Intronic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
941650482 2:168087207-168087229 GCTTACCTGCAGAAGAAAGAGGG + Intronic
947466104 2:230347839-230347861 GCCCAACTGCAGAGGCAAGCTGG - Intronic
947474550 2:230431081-230431103 GTCCACCTGCAGAGGCAAGCTGG - Intronic
947721563 2:232372607-232372629 CCTTCCATCCAGAGGCAAGAAGG - Intergenic
948041101 2:234902214-234902236 CCTCTCCTGCAGAGCCAAGCAGG + Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948806926 2:240457017-240457039 CCTTACCTCCAGATGCCTGCTGG - Intronic
1169062316 20:2670268-2670290 CCTTACCTTCAGAGGTGAGGGGG - Intergenic
1171448090 20:25218699-25218721 CCTCTCCTGCAGGGCCAAGCTGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1173742073 20:45408064-45408086 CCTGGCCTTCTGAGGCAAGCGGG + Exonic
1176082552 20:63281320-63281342 CCTTGGCTGCCGAGGCAAACCGG - Exonic
1176906513 21:14508509-14508531 CCATACTTGCAGGGGTAAGCTGG - Intronic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1178833352 21:36074872-36074894 CCTCACCCTCAGAGGTAAGCAGG - Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180015587 21:45080829-45080851 CCCTACCCCCAGAGGAAAGCAGG + Intronic
1181573886 22:23782057-23782079 CCCCACCCGCAGAGGGAAGCGGG - Intronic
1183930075 22:41230825-41230847 TCTTAGCTGCCGAGACAAGCTGG - Exonic
1184438860 22:44496914-44496936 CCGTGCCCGCAGAGGCCAGCTGG + Exonic
950365898 3:12483966-12483988 CCTTAACTGCACAGGCAGTCTGG + Intergenic
953308619 3:41854449-41854471 CCTTATCTGCACAGACAAGGTGG + Intronic
953578015 3:44128732-44128754 CCTTAGCTGCTGTGGAAAGCTGG - Intergenic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954867148 3:53739367-53739389 CCTTATCTGCAAAGGCGAGTTGG - Intronic
956421906 3:69094360-69094382 CCCTGGCTGCAGAGGCAGGCAGG + Intronic
960988664 3:123296414-123296436 CCTGAGCTGCAGGTGCAAGCAGG - Intronic
962811159 3:138960583-138960605 CCTTCCCCGCAGAGGCCCGCCGG + Intergenic
962832937 3:139159971-139159993 CTTTGCCTGCAGAGGTCAGCTGG - Intronic
963680541 3:148370076-148370098 CATTACCTGCAGAGGGAACTGGG + Intergenic
966295792 3:178421213-178421235 CCTTACCTACACAGGGAAGATGG + Intronic
979722047 4:123911796-123911818 AGTTACCTGCAGAGGCAAAAGGG - Intergenic
979743120 4:124176556-124176578 CCTTAGTTGCTGAGGCAAGGAGG + Intergenic
980413752 4:132458325-132458347 CCTACCCTACAGAGGCAGGCAGG - Intergenic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
986233091 5:5884859-5884881 CCATCCCTGCAGGGGCAGGCAGG - Intergenic
986290228 5:6393858-6393880 CCTTACCTGCACACTCATGCAGG - Intergenic
986401336 5:7384539-7384561 CCTGACATTCAGAGGCATGCAGG - Intergenic
988584790 5:32499096-32499118 CCTGACCTGAAGAGGCCACCTGG + Intergenic
996073534 5:119161831-119161853 TCCTACCTGCAAAGTCAAGCTGG - Intronic
1002465111 5:179404484-179404506 CGTGACCAGCAGAGGCCAGCAGG - Intergenic
1002639630 5:180624659-180624681 CCCTTCCTGCAGAGGCCACCTGG + Intronic
1005114141 6:22317906-22317928 CCACACCAGCAGAGGCAACCTGG - Intergenic
1006728506 6:36217486-36217508 CTTTATCTGAAGAGGCAAGGTGG + Intronic
1007237148 6:40398953-40398975 CCCCACAGGCAGAGGCAAGCAGG - Intronic
1014112195 6:117631045-117631067 CCTTTCCTGGAGAAGCTAGCAGG + Intergenic
1016201587 6:141416914-141416936 CCCTACGTGCAGAGTGAAGCAGG + Intergenic
1016793321 6:148089796-148089818 CCAGTCTTGCAGAGGCAAGCTGG - Intergenic
1018251031 6:161870667-161870689 CCTTTCCTTCACAGGCCAGCAGG - Intronic
1019187923 6:170231754-170231776 CCTTACCTGGAAAGGCGACCTGG - Intergenic
1019408935 7:898319-898341 CCTCACCTGGAGGGGCCAGCAGG - Exonic
1019774701 7:2905705-2905727 CCTGACCTGCAGGAGGAAGCGGG + Intergenic
1023334726 7:39156802-39156824 CTTTTCCTGAAGAGGTAAGCAGG - Intronic
1029591547 7:101510414-101510436 CCTTACCTGCAGGGCCCAGGAGG - Intronic
1032468185 7:132159801-132159823 CCTTTCCTGTCCAGGCAAGCAGG + Intronic
1033657736 7:143384393-143384415 CTATACTTGGAGAGGCAAGCGGG + Intronic
1034224728 7:149473784-149473806 CCTTTTCAGGAGAGGCAAGCTGG + Exonic
1034292158 7:149941495-149941517 CCCTCCCTGCAGAGACAGGCAGG - Intergenic
1034813915 7:154155402-154155424 CCCTCCCTGCAGAGACAGGCAGG + Intronic
1035024208 7:155815597-155815619 CCATAACTGCAGAGCCCAGCGGG - Intergenic
1036078295 8:5524978-5525000 CTTAACCTTCAGAGGCAAGGCGG + Intergenic
1036778329 8:11628728-11628750 CCTGTCCTACTGAGGCAAGCTGG + Intergenic
1037336799 8:17800718-17800740 CCTTCTCAGCAGAAGCAAGCGGG - Intronic
1039583537 8:38686193-38686215 CCACCCCTGCAGAGGCATGCAGG + Intergenic
1041532898 8:58891576-58891598 CCTTACCTACATAGGCAGTCGGG - Intronic
1042911856 8:73835965-73835987 CCTTACCTGCAAACTCAAGAGGG + Intronic
1047334128 8:123919916-123919938 CCTTTCCTGGAGAGGCAAGGAGG + Intronic
1049284382 8:141766781-141766803 CCTTGCCTGCAGAGCCCATCGGG - Intergenic
1050091355 9:2017886-2017908 CCTTTCCTGCAAAGTCAGGCAGG + Intronic
1051123015 9:13773022-13773044 CTTTGCCAGCAGACGCAAGCAGG - Intergenic
1051333747 9:16048016-16048038 CATTGCCTGCAGTGGCAAGTTGG + Intronic
1051357418 9:16252713-16252735 CGTTAGCTGAAGAGGCAGGCGGG - Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1055657390 9:78464953-78464975 CCTGCCCTTCAGAGGCAAGTGGG - Intergenic
1056551948 9:87659701-87659723 CTTTTCCTGCGGTGGCAAGCGGG - Intronic
1056698319 9:88879375-88879397 CCTTTCCTCCAGAGGCCACCTGG + Intergenic
1056807955 9:89743424-89743446 CCTCACCTGCAGAGCCCAGGAGG + Intergenic
1057087086 9:92221114-92221136 CCTTACCTGCAGAGGAACAAGGG + Intronic
1057905645 9:98981011-98981033 AATTACCTGCACAGGTAAGCAGG + Intronic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1060745912 9:126130913-126130935 CCTTCCCCGCTGAGCCAAGCTGG - Intergenic
1061584713 9:131558302-131558324 TCTTGCCTGCAGAGGGAATCTGG + Intergenic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1199070979 X:143475285-143475307 TCCTATCTGCAAAGGCAAGCGGG - Intergenic