ID: 1190118792

View in Genome Browser
Species Human (GRCh38)
Location X:47643669-47643691
Sequence ATGCCCTTACCCAAAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190118792_1190118795 11 Left 1190118792 X:47643669-47643691 CCAGGGGTTTTGGGTAAGGGCAT 0: 1
1: 0
2: 2
3: 13
4: 148
Right 1190118795 X:47643703-47643725 CTGTTATTTTTTTTTTTAATGGG 0: 1
1: 4
2: 74
3: 1025
4: 9570
1190118792_1190118794 10 Left 1190118792 X:47643669-47643691 CCAGGGGTTTTGGGTAAGGGCAT 0: 1
1: 0
2: 2
3: 13
4: 148
Right 1190118794 X:47643702-47643724 ACTGTTATTTTTTTTTTTAATGG 0: 1
1: 1
2: 85
3: 838
4: 6493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190118792 Original CRISPR ATGCCCTTACCCAAAACCCC TGG (reversed) Intronic
903306989 1:22419865-22419887 CTGCCCTTCCCCAAACTCCCTGG - Intergenic
903407441 1:23109807-23109829 ATCCCCTTATCCGAAATCCCTGG - Intronic
903902505 1:26658322-26658344 ATTCCCTTACCCCCAGCCCCTGG - Intergenic
903961614 1:27061359-27061381 ATGCCCATACCCCACACACCTGG - Intergenic
904334963 1:29790943-29790965 CTGTCCTTATCCAAATCCCCAGG - Intergenic
905000705 1:34666414-34666436 AAGGTCTTACCCAAAACCCCTGG + Intergenic
907082263 1:51634649-51634671 AACCCCTTCCCCACAACCCCAGG - Intronic
907959479 1:59265212-59265234 ATGCCCTGATCCAAAGCCCTTGG + Intergenic
915572058 1:156750271-156750293 ATGCCCTCGCCCAAAACCAAAGG + Intronic
916731011 1:167566870-167566892 AATCCCTTACCCAAGACCCTTGG - Intergenic
917164479 1:172097024-172097046 ATGCCCTTAGCCATAAGCCTAGG - Intronic
919779501 1:201213061-201213083 ATGCCCTCACCCCAAAACCTGGG + Exonic
921427649 1:215022717-215022739 TGGCCCTTTCCCAAAACACCAGG + Intronic
924772565 1:247089842-247089864 CTGCCCTTCCCCAATCCCCCTGG + Intergenic
1063531295 10:6833498-6833520 ATAACCTTACCCCCAACCCCAGG - Intergenic
1069038784 10:63672948-63672970 GTACCCATACCCCAAACCCCTGG + Intergenic
1073671638 10:105596955-105596977 ATGCCCATACACACAACCCTTGG - Intergenic
1073736411 10:106352870-106352892 ATGCCCTTGCCCAATCCCCAAGG + Intergenic
1074468406 10:113705148-113705170 ATCCCCTTCCCCAAAAAGCCAGG + Intronic
1076568556 10:131415748-131415770 CTGCCCTTCCCCAGAACCCGGGG + Intergenic
1076695708 10:132246339-132246361 ATGGCTTCCCCCAAAACCCCAGG - Intronic
1077255805 11:1582213-1582235 AGGCTCTTAACCAAAACTCCAGG - Intergenic
1082072031 11:47947054-47947076 AAGCCCTTAAGGAAAACCCCGGG + Intergenic
1083275446 11:61594564-61594586 CTGCCCTCACCCACCACCCCAGG - Intergenic
1084069813 11:66727294-66727316 CTGCCCATACCTGAAACCCCCGG + Intronic
1084293780 11:68196186-68196208 TTGCCCTTCCCCACACCCCCAGG - Intronic
1084854595 11:71974245-71974267 ATGACCTTACTCAAAACAACAGG - Intronic
1085463246 11:76707677-76707699 ATGACCTTTCCCAGGACCCCAGG - Intergenic
1090284782 11:125490498-125490520 AAACCCTTATCCAAAACCCCTGG - Intronic
1091017430 11:132064805-132064827 ATGTTCTGACCCATAACCCCAGG - Intronic
1095942167 12:47734452-47734474 ATGCCCTTTCCCCATGCCCCCGG - Intergenic
1096651963 12:53066265-53066287 TTGCCCAGACCCAAAAACCCTGG + Intronic
1099433461 12:82617021-82617043 TTGACCATACCCAAAACTCCAGG + Intergenic
1101292212 12:103382470-103382492 ATTTCCTGCCCCAAAACCCCTGG + Intronic
1101839690 12:108319121-108319143 ATGCCCTTTGCCAAGAACCCTGG + Intronic
1105468752 13:20672606-20672628 AGCTCCTTACCCAAAACCCCTGG + Intronic
1107260521 13:38484994-38485016 TCCCCCTTACCCCAAACCCCCGG - Intergenic
1108126128 13:47245004-47245026 CTTCCCTTTCCCAGAACCCCTGG + Intergenic
1108371084 13:49769441-49769463 ATGCTCCTTCCCACAACCCCTGG + Intronic
1108520018 13:51238138-51238160 ATGCCCTGACCCACAACAGCTGG - Intronic
1109265054 13:60188474-60188496 ATGTCCATATCCTAAACCCCTGG - Intergenic
1110541307 13:76709555-76709577 AGGCCCTTACCAAAAACTTCTGG + Intergenic
1112114630 13:96338627-96338649 ATTCCGTAACCCAAAACCCCAGG - Intronic
1119120033 14:72066884-72066906 AGTCCCTTATCCAAAACCTCTGG + Intronic
1119263111 14:73249918-73249940 ATGCCCCTCCCCAAGACCCAAGG - Intronic
1121484271 14:94302645-94302667 ATGCACTGAAGCAAAACCCCAGG - Intergenic
1122302130 14:100737150-100737172 CTTCCCTCACCCCAAACCCCTGG + Exonic
1122937839 14:104968120-104968142 ATGCCCTTCCCCCACTCCCCGGG + Intronic
1125060328 15:35412811-35412833 TGCCCCCTACCCAAAACCCCTGG - Intronic
1125457927 15:39879654-39879676 TTGGCCTTAACCAAAACCCAAGG + Intronic
1128363710 15:66982011-66982033 AGGCCCTGACCCAACACCCCGGG + Intergenic
1129616415 15:77101822-77101844 CAGCCCTTGCCCAACACCCCAGG + Exonic
1130524904 15:84696561-84696583 AATCCCTTACTCAAAACCCTTGG + Intronic
1133170966 16:3982302-3982324 CTGCCCTTATCCAACATCCCAGG - Intronic
1136239869 16:28937249-28937271 ATCCCCATCCCCAAACCCCCAGG + Exonic
1142060939 16:88028666-88028688 ATGCCCTTAACCCACACCCCAGG - Intronic
1143451942 17:7041908-7041930 ATGCCCTTACCCATCTCCTCAGG - Exonic
1143856660 17:9856202-9856224 ATGCCCTGTCCCAAAGTCCCAGG + Intronic
1144648373 17:16990719-16990741 ATGCTCTTCCCCAACGCCCCCGG + Intergenic
1148516968 17:48228785-48228807 AGGACCTGGCCCAAAACCCCAGG - Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1150657628 17:67050758-67050780 ATGCCCTTAACCAGAACACTGGG + Intronic
1150710967 17:67530487-67530509 AGGCCCTTATCCAAAATGCCTGG - Intronic
1150852404 17:68716133-68716155 TTGCCATTATACAAAACCCCAGG + Intergenic
1151679199 17:75614872-75614894 ATGCCCCTGCCCCAACCCCCCGG + Intergenic
1152778874 17:82217779-82217801 ATGCCCCTCCCCAACCCCCCAGG + Intergenic
1157441989 18:47718667-47718689 ATGTCCATGCCCAAATCCCCAGG - Intergenic
1157740906 18:50091878-50091900 ATCCCCTTAGCCAAAACCCTTGG - Intronic
1158217624 18:55116488-55116510 ATGCACCTTCCCAAAACTCCAGG - Intergenic
1160514062 18:79468935-79468957 AGGCCCTTCCCCACAATCCCGGG - Intronic
1160514099 18:79469046-79469068 AGGCCCTTCCCCACAATCCCGGG - Intronic
1160661763 19:304498-304520 ATGCCCATCCCCAAACACCCAGG + Intergenic
1161368124 19:3892966-3892988 ATGCCCCTGCCCCAAACCCTGGG + Intronic
1163392717 19:17040042-17040064 ATTCCCTCTCCCAAAGCCCCTGG + Intergenic
1163610316 19:18297530-18297552 ATTCCCTTCCCCCAAGCCCCTGG - Intergenic
1168113003 19:54205246-54205268 CTGCCCTTGCCCACAGCCCCAGG - Intronic
926169949 2:10546789-10546811 ATGCCTTTACCCCATACCCCAGG + Intergenic
927875061 2:26649771-26649793 ATGGCCATACCCCAAGCCCCGGG - Intergenic
933120445 2:78529812-78529834 ATGCCTTCTCCCAAAGCCCCAGG + Intergenic
934663284 2:96154394-96154416 CTGCCCTTACCCAGACCCCGTGG + Intergenic
937257410 2:120565120-120565142 ATGGCCCGACCCAACACCCCAGG - Intergenic
940593311 2:155757365-155757387 ATGGCCTGACCCAAGATCCCAGG - Intergenic
942342977 2:174969116-174969138 AATCCCTTATCCAAAACCCTTGG - Intronic
942858478 2:180581383-180581405 ATGCACTTCCCCAAACCCTCAGG + Intergenic
943878234 2:193102135-193102157 ATGCCATTACCCACAATCCTAGG - Intergenic
946355426 2:219181554-219181576 ATCCCCTCTCCCAAAACCTCTGG - Intronic
948094592 2:235323727-235323749 AAGCCCCTACCCACAACCCTGGG - Intergenic
948110248 2:235449099-235449121 GGGGCCTTTCCCAAAACCCCAGG + Intergenic
948537102 2:238654442-238654464 TTGACCATAACCAAAACCCCAGG - Intergenic
948647780 2:239418911-239418933 ATCCTCTACCCCAAAACCCCAGG + Intergenic
948712600 2:239834293-239834315 ATGACCTTACCCACATTCCCTGG + Intergenic
948862475 2:240759525-240759547 CTGGCCTTTCCCACAACCCCAGG + Intronic
1169113881 20:3050163-3050185 ATGGCCTTGCTCAAAACACCAGG + Intergenic
1170394388 20:15910092-15910114 ATGTTCTTTCTCAAAACCCCTGG + Intronic
1172010214 20:31842176-31842198 CTGCCCTTCCCCACAACCACCGG + Intergenic
1172177178 20:32979571-32979593 CTGCCCTCACCCAAGTCCCCAGG - Intergenic
1173327381 20:42046383-42046405 ATGCATTTTCCCAAAACTCCTGG - Intergenic
1175880752 20:62257349-62257371 TTACTCTTATCCAAAACCCCAGG + Intronic
1180612169 22:17105191-17105213 ATCCCCCCACCCCAAACCCCAGG + Intronic
1181638980 22:24187096-24187118 GTGCCCTCACCCACAGCCCCTGG + Intronic
1182000188 22:26913754-26913776 ATGCCCTTCCCCATCCCCCCAGG + Intergenic
1183487611 22:38097821-38097843 CTGGCCTTACCCAGAATCCCCGG - Intronic
1184308610 22:43626703-43626725 AAGCCCTTCCCCAAGAGCCCCGG + Intronic
1185036338 22:48479119-48479141 AAGCTCTTCCCCAGAACCCCTGG + Intergenic
950197524 3:11019481-11019503 ATCCCCCTACCCACAACCCCTGG - Intronic
951536465 3:23744849-23744871 CTGCCTTTACCCTAAGCCCCAGG - Intergenic
951683155 3:25315555-25315577 ATGGTCTTATCCAAAAACCCAGG - Intronic
952750301 3:36819550-36819572 TTCCCCTTACCCACAGCCCCTGG - Intergenic
953228464 3:41042862-41042884 TTGGCCCTACCCAACACCCCTGG + Intergenic
953853652 3:46484788-46484810 ATGCCCCTACCCACCACCTCGGG + Intronic
961074485 3:123969170-123969192 ATGACTTTACCCAAAACCCCAGG - Exonic
961309195 3:125983283-125983305 ATGACTTTACCCAAAACCCCAGG + Exonic
962474041 3:135740236-135740258 GTGCCCTTACCCAGCAGCCCAGG + Intergenic
964917706 3:161856087-161856109 CTGCCCTTTCCCCTAACCCCTGG - Intergenic
965944734 3:174226292-174226314 ACCCCCTTACCCACCACCCCTGG + Intronic
967453789 3:189657167-189657189 TTCCCTTTACCCCAAACCCCTGG - Intronic
969316346 4:6383467-6383489 TTGCCCTTTCCCAAAAGTCCTGG + Intronic
972785366 4:42321578-42321600 ATGTCCTTACCCCCAACCCAGGG + Intergenic
976247679 4:83019935-83019957 ATTCCCTTATTCAAAACCCCTGG - Intergenic
976713432 4:88098321-88098343 ATGCACACACACAAAACCCCCGG - Intronic
979185030 4:117777942-117777964 ATCCACTTGCCCAAAAGCCCAGG + Intergenic
979624718 4:122831381-122831403 GTGGCTTTATCCAAAACCCCAGG - Intronic
988707210 5:33738167-33738189 AGGCCATTACCAAAGACCCCAGG - Intronic
993061681 5:83046121-83046143 TTGCCTTTACACAAAACCCTTGG + Intergenic
995458822 5:112380965-112380987 AATCCCTTACCCAAAACTCATGG + Intronic
995541240 5:113188060-113188082 ATCCCCTTTTCAAAAACCCCGGG - Intronic
997209976 5:132071592-132071614 ATACCCATTCCTAAAACCCCAGG + Intergenic
999179205 5:149656958-149656980 TTTCCCTTTCCCAAAGCCCCCGG - Intergenic
1003763269 6:9207301-9207323 ATGAGTTTACCCAAAACCCTGGG - Intergenic
1003810476 6:9774010-9774032 ATGCCCTTACCCGTAACACTTGG + Intronic
1003981634 6:11395620-11395642 ATTCCCTTGCCCAAAGCCCTTGG + Intergenic
1018560797 6:165099260-165099282 TTTCCCCTCCCCAAAACCCCTGG + Intergenic
1020004522 7:4775366-4775388 ATGCCCTCTCCCAAAGCCCCAGG + Intronic
1021206707 7:17789159-17789181 ATGCCCTCAATGAAAACCCCAGG + Intergenic
1024364697 7:48507732-48507754 ATGCCCTTAGCCAACATGCCTGG + Intronic
1026654325 7:72243659-72243681 GTGACCTTAGACAAAACCCCTGG + Intronic
1026776620 7:73234917-73234939 CTGCCCATCCCCAAAGCCCCCGG - Intergenic
1027017471 7:74788287-74788309 CTGCCCATCCCCAAAGCCCCCGG - Intronic
1027070551 7:75157645-75157667 CTGCCCATCCCCAAAGCCCCCGG + Intergenic
1029681975 7:102117634-102117656 ATGCCCTTCCCCAGCTCCCCTGG - Intronic
1032925288 7:136597633-136597655 CTGCACTTAACCAAAACCACTGG - Intergenic
1033982248 7:147179767-147179789 ATCCTCTTTCCCAAAACCACTGG - Intronic
1038756891 8:30350161-30350183 ATACCCTGACACAGAACCCCTGG + Intergenic
1039550645 8:38440555-38440577 AAGCCCTTCTCCAAATCCCCTGG - Intronic
1040328537 8:46374481-46374503 GTGCCCTTCGCCAAAACCACAGG + Intergenic
1042021096 8:64371825-64371847 GTGGCCTTACTCAAAACCCCAGG + Intergenic
1042177200 8:66048306-66048328 CTGCCCTTTCCCCCAACCCCAGG - Intronic
1044293474 8:90500123-90500145 ATCCCCTTCTCCAAAACTCCTGG - Intergenic
1046764692 8:118056937-118056959 ATGCCATTACCAAAAAGCCATGG + Intronic
1046852929 8:118996043-118996065 GTCCCCTCTCCCAAAACCCCTGG + Intronic
1046869464 8:119189184-119189206 TTGCCTTTAACCAAGACCCCAGG - Intronic
1047271451 8:123363466-123363488 AACCCCTTATCCAAAACCCTTGG - Intronic
1048079218 8:131106841-131106863 AGGCCCTTCCCTAAAACTCCAGG + Intergenic
1048203700 8:132398823-132398845 ATGGGCTTTCCCAGAACCCCAGG + Intronic
1051190081 9:14502058-14502080 AATCTCTTACCCAAAACCCCTGG + Intergenic
1055022112 9:71681368-71681390 GTGCCCTTATCCACAACACCAGG + Intergenic
1056376980 9:86024364-86024386 AAGCCGATACCCAAAACCCTGGG + Intergenic
1061193299 9:129094535-129094557 TTGCCCCTACCCACAACCCATGG + Intergenic
1061667303 9:132168114-132168136 ATGCCTTTACCCGTCACCCCTGG - Intronic
1187217006 X:17286934-17286956 ATCCCCTTGCCCAAAGCCCATGG - Intergenic
1187625282 X:21105224-21105246 ACCCCCTCCCCCAAAACCCCAGG - Intergenic
1190118792 X:47643669-47643691 ATGCCCTTACCCAAAACCCCTGG - Intronic
1191853934 X:65607649-65607671 AGGACCTTACCCAAGAACCCAGG - Intronic
1194673167 X:96760615-96760637 ATGTCCTTACTCAAGAACCCAGG - Intronic