ID: 1190119553

View in Genome Browser
Species Human (GRCh38)
Location X:47649417-47649439
Sequence TTCCCCCAATTACAAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190119553 Original CRISPR TTCCCCCAATTACAAAGCAC TGG Intronic
904583627 1:31566374-31566396 CTACCCAAATTACAAAACACCGG + Intergenic
908185577 1:61649825-61649847 TTCCCCCTGTTTGAAAGCACAGG + Intergenic
909315936 1:74219142-74219164 TTCTCCCACTTACAGAACACTGG + Intronic
909806453 1:79878334-79878356 TGCCCCCAGTTAAAAGGCACAGG + Intergenic
913112394 1:115668120-115668142 TTCCCACAATTACAAAGTGTGGG - Intronic
913970746 1:143414287-143414309 TACCCCCAATTAAAAAGCAGAGG - Intergenic
914065123 1:144239898-144239920 TACCCCCAATTAAAAAGCAGAGG - Intergenic
914114028 1:144726456-144726478 TACCCCCAATTAAAAAGCAGAGG + Intergenic
924274296 1:242369861-242369883 TTCTTCCAATTACTAAGCAGAGG + Intronic
1063727295 10:8651959-8651981 TTTCTCCAATTACAAAGTAAAGG + Intergenic
1065440806 10:25751669-25751691 TTTCCCAAATTATAAAACACTGG - Intergenic
1068992226 10:63162061-63162083 GTCCCACAAATACAAACCACAGG - Intergenic
1069825381 10:71252078-71252100 TTCACCCATTTTTAAAGCACAGG - Intronic
1070600350 10:77861948-77861970 ATCCCCCAATTACAAAAGGCCGG - Intronic
1071120599 10:82272588-82272610 TTCTCCCATTGAAAAAGCACAGG + Intronic
1074938017 10:118205577-118205599 TTCACCCATTAACAATGCACAGG + Intergenic
1077703013 11:4459055-4459077 TTCCCCCACTTTCAAAGGAGAGG - Intergenic
1084556441 11:69878896-69878918 TTCCCCCAACCCCATAGCACAGG - Intergenic
1084971863 11:72776487-72776509 CTCCCACAATGACACAGCACAGG + Intronic
1085092577 11:73731006-73731028 ATCTCCCAATTTAAAAGCACAGG + Intronic
1087767088 11:102167099-102167121 TTTGCCCAATCACAAACCACTGG - Intronic
1089021757 11:115222811-115222833 TACCCCCATTTAAAAAGCAGTGG - Intronic
1090589029 11:128245556-128245578 CTCCCACAATTAGTAAGCACAGG - Intergenic
1095921308 12:47533883-47533905 CTCCCCCAATAATAAAGCACTGG + Intergenic
1096797722 12:54088615-54088637 TTCCCTCATTTGCAAAACACAGG - Intergenic
1097793248 12:63837354-63837376 TCACACCAATTACAAAGCGCAGG + Intergenic
1098455212 12:70665302-70665324 AACCACCAGTTACAAAGCACTGG - Intronic
1101013984 12:100480610-100480632 ATCCCCCAATCCCAAAGCCCAGG + Intronic
1101288755 12:103344440-103344462 TTCCCCTATTTAGAAAGCTCTGG + Intronic
1102180958 12:110911824-110911846 TTTCCCCATTTAAAAAGCATTGG + Intronic
1104283394 12:127399439-127399461 TTACCCCACTTCCAAATCACAGG + Intergenic
1107168425 13:37311257-37311279 TTCTCCCAATGACAAATCACTGG - Intergenic
1112726993 13:102316038-102316060 TTCCCCTAATGAGACAGCACTGG - Intronic
1114933450 14:27504891-27504913 TACCCTCAATTAAAAGGCACAGG - Intergenic
1115261642 14:31460611-31460633 TGACCCCAAGTACTAAGCACAGG + Intergenic
1117316896 14:54579942-54579964 TTCCACCACTTACAAACAACAGG - Intronic
1121538256 14:94706140-94706162 TCACCCCAATTCCACAGCACTGG + Intergenic
1121872702 14:97423854-97423876 TTCCCCAAATTACAACCAACTGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1126146775 15:45481853-45481875 TTCCTACAAAAACAAAGCACAGG + Exonic
1126380471 15:48041531-48041553 TTCACTGAATGACAAAGCACAGG + Intergenic
1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG + Intronic
1127980639 15:64032536-64032558 TTCCCCCAAGTGCTAAGCAGGGG - Intronic
1130039005 15:80388256-80388278 TTCCCCTAATTATAAAGCACGGG + Intronic
1130127202 15:81103898-81103920 TTCCCCCATTCACCAAGCAGCGG - Intronic
1130672373 15:85923818-85923840 TTCCCCCAGGTACAAAGCCCAGG - Intergenic
1130693410 15:86105712-86105734 ATCCCTCAGTTACAAAGCCCAGG + Intergenic
1130803138 15:87287787-87287809 TTCTCAGAATTACAAAGTACTGG - Intergenic
1131115709 15:89794012-89794034 AACCCCCAATAACAAAGAACAGG + Intronic
1132988558 16:2780782-2780804 TTCCCCCACACACTAAGCACTGG - Intergenic
1137271709 16:46906692-46906714 TTCCCACAGTTCCAAAGCAATGG + Intronic
1137902122 16:52280046-52280068 CTTCCCCCATGACAAAGCACTGG + Intergenic
1140341167 16:74164333-74164355 ATCCCCCAATTAAAAAGCAAAGG + Intergenic
1141406409 16:83797731-83797753 TTTTCCCAATTACTGAGCACAGG + Intronic
1141858059 16:86698202-86698224 ATCCCCAAATCACAAAGAACAGG - Intergenic
1142000550 16:87661833-87661855 TTTCCCCAATTACGAAGCCAGGG + Intronic
1143420004 17:6781311-6781333 TCTCCCCAATTACCAGGCACTGG - Intronic
1149454834 17:56779499-56779521 TTCCCACATGTACAAAGCAACGG + Intergenic
1149880294 17:60283254-60283276 TTGCCTCAACTACAGAGCACTGG - Intronic
1150753540 17:67889164-67889186 TTCCTCCTATTATAAAGCAGTGG - Intronic
1151067412 17:71167665-71167687 TTCCCCCAAACCCAAAGCAATGG + Intergenic
1151411478 17:73933178-73933200 TTCACCAAATTACAAAGCAAAGG - Intergenic
1153331058 18:3875479-3875501 CTCCTCCAAATACAAAGCAGAGG - Intronic
1156626663 18:38918233-38918255 ATACCCCAATTAAAAGGCACAGG - Intergenic
1158095705 18:53768093-53768115 TGACCCCAATTAAAAGGCACAGG + Intergenic
1158557069 18:58484087-58484109 TTCTGCCATTTACTAAGCACTGG - Intronic
1158795525 18:60841214-60841236 CTGCCCCAAATAAAAAGCACAGG + Intergenic
1160423560 18:78765755-78765777 TTTCCCCAAGGACAGAGCACGGG + Intergenic
1160735808 19:661944-661966 TTTCCCCATCTATAAAGCACGGG + Intronic
1167022159 19:46885470-46885492 TACCCCCACTTAGAAAGTACTGG + Intergenic
1167882156 19:52469034-52469056 TTCACACAATTACAAGGCAAAGG - Intronic
925844928 2:8026595-8026617 TGCCTCCAATTCCAAAGCATTGG - Intergenic
927574339 2:24189228-24189250 TTCCCCTTATGACAAAGCCCAGG + Intronic
931870364 2:66451113-66451135 TTCACCTAATTGTAAAGCACAGG - Intronic
934175442 2:89575212-89575234 TACCCCCAATTAAAAAGCAGAGG - Intergenic
934285758 2:91649575-91649597 TACCCCCAATTAAAAAGCAGAGG - Intergenic
935606564 2:104977289-104977311 TTCTCCCAATACCAAAGCAATGG - Intergenic
935866768 2:107395654-107395676 TTCCCAAAATTATAAAGCAGTGG - Intergenic
936079934 2:109425596-109425618 TTGTCCCATTTACACAGCACAGG - Intronic
943251648 2:185528955-185528977 TTCTCCCATTTATAAAGGACAGG + Intergenic
943905807 2:193500237-193500259 TTGCTCCATTTATAAAGCACAGG - Intergenic
947681191 2:232035462-232035484 ATCCCCCAATTAAAAGGCACAGG - Intronic
948323935 2:237095897-237095919 TTCACCCATTTACGCAGCACTGG + Intronic
1170252329 20:14298002-14298024 TTCTTCCATTTACAGAGCACAGG - Intronic
1171184431 20:23114869-23114891 TTCCCCCAATTCCGAATTACTGG + Intergenic
1172127585 20:32634081-32634103 GTCCCCCAAGGACAAAGCTCAGG - Intergenic
1174060184 20:47826929-47826951 TCCCCGCAAGTACAAAGAACAGG + Intergenic
1174530442 20:51208597-51208619 ATCCCACAATTACACAGCAGTGG - Intergenic
1177662334 21:24101348-24101370 TGCCCCCACTTAAAAGGCACAGG - Intergenic
1178793234 21:35719647-35719669 TTTCCTAAATTACAAGGCACAGG + Intronic
1180687324 22:17679832-17679854 TTCCCCTTATTACCAACCACAGG + Intronic
1181280132 22:21713956-21713978 TTCCCCAAATTCGAGAGCACGGG + Intronic
1182970471 22:34569744-34569766 TTCCCCCATTTCCAAAGTACAGG + Intergenic
1185371704 22:50463998-50464020 TTCCATCAAGTACAAAGAACAGG + Intronic
955224141 3:57047500-57047522 TTTCCCCAACTAGAAAGCAGGGG + Intronic
955694192 3:61619340-61619362 CTCCCTCAGTTACAAACCACTGG - Intronic
956598306 3:70992862-70992884 TGGCTCCAGTTACAAAGCACTGG + Intronic
960549272 3:118955709-118955731 TTATTCCATTTACAAAGCACAGG + Intronic
972561980 4:40237150-40237172 TCCCCACAAGAACAAAGCACTGG + Intronic
974469430 4:62299182-62299204 TTCCCCTAATTCCTAACCACTGG - Intergenic
975701816 4:77074996-77075018 TCCCCCGAATTTCACAGCACCGG + Intronic
978542688 4:109835990-109836012 TTCTCCCTATTATCAAGCACAGG - Exonic
978684934 4:111429303-111429325 TTCCCACAAATAAAAAGCTCTGG - Intergenic
979695111 4:123604103-123604125 TTGCCCCACTTATAGAGCACAGG - Intergenic
980567639 4:134564917-134564939 TTCCCCCAACCCCAAAGCCCTGG + Intergenic
983188809 4:164732411-164732433 GTCCACCAAGTACAAAGCAATGG + Intergenic
983425049 4:167573330-167573352 TTCCTCCCATCACAATGCACAGG + Intergenic
986369921 5:7069616-7069638 TTCCACCAATCACCCAGCACTGG - Intergenic
986376404 5:7136465-7136487 GTAACCCCATTACAAAGCACTGG + Intergenic
986593991 5:9401548-9401570 TTCCACCATTGCCAAAGCACAGG + Intronic
987802542 5:22717783-22717805 GTCCCCCAATTGCAAACCTCAGG - Intronic
990314188 5:54568533-54568555 TTCCCCCATTTCCAAAGGAAGGG + Intergenic
992154230 5:73939284-73939306 TGCCACCATTTACAGAGCACAGG - Intronic
993402910 5:87474754-87474776 ATGCCCCAATTAAAAAACACAGG + Intergenic
994380981 5:99071011-99071033 ATCCAACACTTACAAAGCACAGG - Intergenic
995693668 5:114856142-114856164 TTCCCCCATTTCCAGATCACAGG - Intergenic
999199489 5:149805857-149805879 TTCCTCCCATTTCAAAGCCCAGG + Intronic
1000514789 5:162226639-162226661 TTCCCCCAACTTCAGAGCTCAGG - Intergenic
1001268965 5:170296709-170296731 TTCTGCCAATGACCAAGCACAGG + Intronic
1004569245 6:16829289-16829311 TTTTTCCAATTACACAGCACAGG + Intergenic
1008405500 6:51114436-51114458 TTTCCTCAATTACAATGCAATGG + Intergenic
1010181149 6:73087879-73087901 TTCCCCCTCTTTCAAAGCCCAGG + Intronic
1011781778 6:90797584-90797606 GTCCCTGAATGACAAAGCACAGG - Intergenic
1012347927 6:98214460-98214482 TTCCCCCATAAACATAGCACTGG + Intergenic
1016616810 6:146059453-146059475 TTGCTCCATTTATAAAGCACAGG + Intronic
1016662246 6:146595253-146595275 TTGCCCAAAGTCCAAAGCACAGG - Intergenic
1018329467 6:162711730-162711752 TTCCCCCATATAGAGAGCACAGG - Intronic
1018889730 6:167975250-167975272 TTCCCCCTATTACAAAGTTCTGG - Intergenic
1019820192 7:3236896-3236918 TACCCCCAGTTACAAGGCAATGG - Intergenic
1021366431 7:19785193-19785215 ATGCCCCAATTAAAAGGCACAGG + Intergenic
1023154066 7:37230415-37230437 TTCCACCACTTGGAAAGCACAGG + Intronic
1025028112 7:55534796-55534818 TTCCCCAAAGTCCAGAGCACTGG - Intronic
1026614497 7:71889456-71889478 TCCCCCCATTTGCAAATCACTGG + Intronic
1026902375 7:74044357-74044379 TTCCCCAAACTCCAAAGCTCAGG + Intronic
1027596171 7:80176978-80177000 TTCTTCCATTTACAGAGCACAGG - Intronic
1028660970 7:93274440-93274462 TTACTCCACTTACAGAGCACAGG - Intronic
1031724265 7:125217600-125217622 TTCCCCCAAAAAATAAGCACAGG + Intergenic
1034604556 7:152299746-152299768 TACCCCCAATTAAAAAGCAGAGG + Intronic
1040422263 8:47251644-47251666 TCCCCCCAGTTCCCAAGCACAGG - Intergenic
1042149851 8:65769951-65769973 TTCACCTAATTAAAAATCACGGG - Intronic
1042967365 8:74369085-74369107 TGCCCTCCATAACAAAGCACAGG + Intronic
1044191121 8:89318918-89318940 TACCTCCAATTACAAAGAAAGGG + Intergenic
1052236811 9:26220567-26220589 ATCCCTCAAGTACAAATCACTGG + Intergenic
1053001387 9:34578796-34578818 TTCCCCCAAATTCCCAGCACTGG - Intronic
1055569720 9:77604276-77604298 TTTCTCTAAATACAAAGCACAGG - Intronic
1057853296 9:98581923-98581945 TTCTCACAAATACAAAACACTGG + Intronic
1061274699 9:129562978-129563000 TTCCACCTCTTCCAAAGCACAGG + Intergenic
1185713992 X:2326641-2326663 TTCCCCCAATAACACACAACTGG - Intronic
1185910656 X:3977527-3977549 TTCCCCCAAACACCAAGCAGTGG - Intergenic
1186304023 X:8234515-8234537 TTCTTCCATTTACAGAGCACAGG + Intergenic
1187644360 X:21330492-21330514 ATGCCCCAATTAAAAGGCACAGG + Intergenic
1189225117 X:39406508-39406530 TCCCACCCATGACAAAGCACAGG + Intergenic
1190119553 X:47649417-47649439 TTCCCCCAATTACAAAGCACTGG + Intronic
1191654626 X:63583098-63583120 TTCACCCCATTATGAAGCACAGG - Intergenic
1192196008 X:69028655-69028677 TTCCCCCAGTTACCTAGCACTGG + Intergenic
1193028915 X:76876885-76876907 TGCCCCCAAGTAAAAGGCACAGG + Intergenic
1194167820 X:90542159-90542181 TTGTCCCATTTACAGAGCACAGG + Intergenic
1196547877 X:116985659-116985681 TTCTTCTATTTACAAAGCACAGG + Intergenic
1196946369 X:120831022-120831044 ATCCCCCAATTAAAAGACACAGG - Intergenic
1200514075 Y:4119949-4119971 TTGTCCCATTTACAGAGCACAGG + Intergenic
1201379112 Y:13353288-13353310 TTATCCCATTTATAAAGCACAGG - Intronic