ID: 1190122597

View in Genome Browser
Species Human (GRCh38)
Location X:47674549-47674571
Sequence AGGGAGAACACAGTGAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190122597_1190122602 14 Left 1190122597 X:47674549-47674571 CCCACATTCACTGTGTTCTCCCT No data
Right 1190122602 X:47674586-47674608 GATTCTCTCTCTGCACCACATGG 0: 3
1: 13
2: 32
3: 73
4: 308
1190122597_1190122603 28 Left 1190122597 X:47674549-47674571 CCCACATTCACTGTGTTCTCCCT No data
Right 1190122603 X:47674600-47674622 ACCACATGGCCACTGCCAGATGG 0: 2
1: 1
2: 2
3: 11
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190122597 Original CRISPR AGGGAGAACACAGTGAATGT GGG (reversed) Intergenic
No off target data available for this crispr