ID: 1190123047

View in Genome Browser
Species Human (GRCh38)
Location X:47679306-47679328
Sequence AATTGGGTATAGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190123041_1190123047 -2 Left 1190123041 X:47679285-47679307 CCTTATGGCTATCATATTTAAAA No data
Right 1190123047 X:47679306-47679328 AATTGGGTATAGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190123047 Original CRISPR AATTGGGTATAGAGGGATGA GGG Intergenic
No off target data available for this crispr