ID: 1190124548

View in Genome Browser
Species Human (GRCh38)
Location X:47692141-47692163
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 7, 1: 41, 2: 45, 3: 77, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190124548 Original CRISPR ATGTACAACATGAGGACTAT AGG Intergenic
907674440 1:56505849-56505871 TTGAACAACATGGGGACTAGAGG - Intronic
908857271 1:68444992-68445014 ATGCACAACATGAAGAATAAAGG + Intronic
908948206 1:69525447-69525469 ATGGACAACCTCTGGACTATGGG + Intergenic
908966780 1:69774458-69774480 ATGTACAGCATGAGGACTATAGG + Intronic
909163262 1:72181973-72181995 ATGTACAATATGCGGACCAGAGG + Intronic
909680238 1:78283726-78283748 ATGTGCAACATCAGGAGTATAGG - Intergenic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910631563 1:89360798-89360820 CTGTACAACATAAGAACCATAGG - Intergenic
910732630 1:90414590-90414612 AAGTACAAAATGAGCACAATGGG + Intergenic
910896758 1:92078004-92078026 ATGTACAGCATGAGAACTATAGG - Intergenic
911047924 1:93643711-93643733 ATGGACAACATGAGGACTATAGG + Intronic
911279842 1:95910991-95911013 ATGTTCATCATCAGGAATATTGG + Intergenic
911453707 1:98096925-98096947 ATGATGAACATGAGGACTAGAGG + Intergenic
911545333 1:99209535-99209557 GTGTACCACATAAGGACTTTTGG - Intergenic
913461802 1:119094749-119094771 AAATACAACATGAGGACTATAGG - Intronic
913482523 1:119302475-119302497 AAATACAACATGAGGACTACAGG + Intergenic
914931818 1:151941756-151941778 AGGTATGACATAAGGACTATGGG - Intergenic
916509494 1:165459331-165459353 GTGTGCAACATGAGGACTGTAGG + Intergenic
916820208 1:168390870-168390892 CTATACAACATGAGGACTATAGG + Intergenic
916906174 1:169286683-169286705 TTGTACAACAGGAGTGCTATTGG + Intronic
916989281 1:170224961-170224983 TTGTACAGCATGATGACTACAGG + Intergenic
918622330 1:186619839-186619861 ATATATGACATGAGGACTGTAGG - Intergenic
918967253 1:191367345-191367367 ATGTACAATATAAGGATTATAGG + Intergenic
922823076 1:228497624-228497646 ATGTACAACAGGAGGAATGTAGG + Intergenic
923113371 1:230911078-230911100 GTATAAAACATGAGGATTATGGG + Intronic
924292272 1:242548639-242548661 ATGCACAACATAAGAACTACAGG + Intergenic
924800249 1:247324391-247324413 TTGCACAACATGGTGACTATAGG + Intronic
1063342037 10:5275006-5275028 TTGAGCCACATGAGGACTATAGG + Intergenic
1064798869 10:19045982-19046004 ATGTACAGCATGAGTACTATAGG - Intergenic
1065639167 10:27764126-27764148 ATGTACAAGATGAGGATTATAGG + Intergenic
1065734884 10:28742629-28742651 AGGTACAGCATGGTGACTATAGG + Intergenic
1067915100 10:50388922-50388944 ATGTACAATATGAGGATGATAGG + Intronic
1068163540 10:53299094-53299116 ATGTACAGCATGAGGACTATAGG - Intergenic
1068443753 10:57094757-57094779 TTTTGCAACATGAGGACTGTAGG - Intergenic
1069393441 10:67962162-67962184 ATGTCCTACAAGAGGAATATTGG - Intronic
1070336032 10:75455871-75455893 CTGTACAACATCAGGGCTTTGGG + Intronic
1070946889 10:80399638-80399660 ATGCACAGCATGAGGATTATAGG - Intergenic
1071274838 10:84044146-84044168 ATGAACAACATGAGAACCATAGG - Intergenic
1071362237 10:84860298-84860320 ATGTACTGCATGAGGACTATGGG - Intergenic
1075964695 10:126601270-126601292 ATGTACAACATGAGGACTCTAGG + Intronic
1077741665 11:4853126-4853148 ATGTACAGCATGATGATTATAGG + Intronic
1081156114 11:39693234-39693256 TTGAACAACATGAGGATTAGGGG - Intergenic
1081201350 11:40219813-40219835 AGCTACAACATGAGAACTAAAGG + Intronic
1082614785 11:55345836-55345858 ATATACAGCATGAGGACAATAGG - Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1082926856 11:58557627-58557649 ATGTACAACATAAGAACTATCGG + Intronic
1083131400 11:60626498-60626520 ATGTACAGCATGAGGACTATAGG + Intergenic
1086276809 11:85139695-85139717 ATGTACACCATGAGGACTGTAGG - Intronic
1087867637 11:103251600-103251622 ATGTACAACATGAGGACTGTAGG - Intronic
1088275070 11:108076350-108076372 ATGTACAGCATGAGAACTATAGG - Intronic
1088358453 11:108967267-108967289 ATGTACAAAATGCTGAATATTGG - Intergenic
1091182356 11:133618432-133618454 ATCTACAAAATGGGGACAATGGG - Intergenic
1092321445 12:7480606-7480628 ATGTACAACATGAGGATTATAGG + Intronic
1092927616 12:13286287-13286309 ATTTACAGCATGAGAACTATTGG + Intergenic
1093398102 12:18708076-18708098 ATGTATCATATGAGGATTATAGG - Intronic
1095047052 12:37518491-37518513 ATATACAACATGAGGACTATAGG + Intergenic
1098101844 12:67026308-67026330 ATGTAGAATATGAGAACTATGGG - Intergenic
1098606308 12:72395106-72395128 TTGTACAACATGGAGACTATAGG - Intronic
1098664148 12:73139313-73139335 ATGTACAAATAGAGGACCATGGG + Intergenic
1098795545 12:74884011-74884033 ATGTACAACATGAGGACTATTGG + Intergenic
1099169565 12:79347556-79347578 ATTTTCAACATGAGGTTTATAGG - Intronic
1099793855 12:87371122-87371144 ATGTACAACATGAGGATTAAAGG - Intergenic
1100048824 12:90418675-90418697 ATGTACGACATGAGGACTATAGG + Intergenic
1100949266 12:99827459-99827481 AAGTACAACATGAAGACTACAGG + Intronic
1101133304 12:101711606-101711628 ATGTACAACCTGAGGGGTATAGG + Intronic
1101482712 12:105116544-105116566 ATGTACAACATGAAGATTACAGG + Intronic
1101784410 12:107870429-107870451 ATGCACAACAGGAGTACTACAGG + Intergenic
1101933014 12:109030516-109030538 ACGTACAGCATGGTGACTATAGG + Intronic
1102176280 12:110877541-110877563 AGGTACAACATCAGGACTCCAGG - Intronic
1106871223 13:34023957-34023979 ATGTAAAAAATGTGGAATATTGG + Intergenic
1106966369 13:35074876-35074898 ATGTACAACATGAGGACTGTAGG - Intronic
1107539353 13:41371781-41371803 ATGAACAACATGAGCATTAGGGG - Intronic
1108883192 13:55146641-55146663 TGTTACAACATGAGGACTTTGGG - Intergenic
1109076247 13:57839675-57839697 ATGTACAGTGTGAGAACTATAGG - Intergenic
1109099660 13:58165093-58165115 ATGTTCAACATGTTGACAATTGG + Intergenic
1109316135 13:60752309-60752331 TTGGACACCATGAGGACTTTGGG - Intergenic
1109757523 13:66780026-66780048 ATATACAACATGAAGATTATAGG + Intronic
1112601568 13:100860637-100860659 ATGTACAACACGAGTACTGTAGG - Intergenic
1114877040 14:26733020-26733042 TTGTACAACATGGTGACTATAGG - Intergenic
1115303013 14:31905185-31905207 ATGTACCCTATGAGGACTAGAGG - Intergenic
1115935339 14:38545952-38545974 ATGTACAGCATGGTAACTATAGG + Intergenic
1116140616 14:40989197-40989219 ATCAACAACAAGAGGAATATTGG - Intergenic
1116167555 14:41352450-41352472 TTGTCCAACATGAGGCCTATGGG + Intergenic
1116290188 14:43024510-43024532 ATGTACGATGTGAGGACTATGGG + Intergenic
1120931742 14:89855688-89855710 AGGTACAACATGAGCACTACAGG - Intronic
1121735341 14:96214167-96214189 ATGGAAAACATGAGGACTGGCGG - Intronic
1121903704 14:97720015-97720037 ATGTACAACATAAGGACTACAGG - Intergenic
1123471688 15:20559692-20559714 ATGTACAACGCGAGAAATATAGG - Intergenic
1123683383 15:22779938-22779960 ATGTATGACATGAGGACTGCAGG - Intronic
1123731991 15:23154677-23154699 ATGTACAACGCGAGAAATATAGG - Intergenic
1123750127 15:23352059-23352081 ATGTACAACGCGAGAAATATAGG - Intergenic
1124282495 15:28375978-28376000 ATGTACAACGCGAGAAATATAGG - Intergenic
1124300208 15:28535627-28535649 ATGTACAACGCGAGAAATATAGG + Intergenic
1125647758 15:41286891-41286913 ATGTACAACATGACAACTATAGG - Intergenic
1127050071 15:55072811-55072833 AGGTACAACATAAGAACTATAGG + Intergenic
1129573851 15:76719473-76719495 ATGTACAACAGGAGGGCTATAGG + Intronic
1131915265 15:97258175-97258197 CTGGACACCATGAGGACTACTGG - Intergenic
1133564356 16:6979087-6979109 ATGTTCAACATGATGATTATGGG + Intronic
1133664687 16:7954979-7955001 CTGTACAACATTATGCCTATAGG - Intergenic
1133847634 16:9470487-9470509 ATGTACAACATGAAGACTATAGG - Intergenic
1134470293 16:14519184-14519206 TGATACAACATCAGGACTATAGG - Intronic
1138725192 16:59129642-59129664 TTGTACAACATGGTGACTAGAGG - Intergenic
1139173635 16:64662047-64662069 ATGAACAATATTAGAACTATAGG + Intergenic
1139629027 16:68216240-68216262 ATGTACAAAATGAGCAAAATAGG + Intronic
1143120497 17:4603602-4603624 AGGGACAGCATGAGGACTCTAGG - Intronic
1145818462 17:27812466-27812488 ACGTAGAACATGAAGACTCTTGG + Intronic
1146118772 17:30170382-30170404 ATGTACCACATGAGGACAATAGG - Intronic
1147239959 17:39084252-39084274 CTGTATAACATGAGGACTGTAGG + Intronic
1149399368 17:56278894-56278916 ATGTACAACATGAAGCTTAAAGG + Intronic
1149646332 17:58244274-58244296 ATGTACAGGCTGAGGACTTTAGG - Intronic
1150928559 17:69559887-69559909 TCAAACAACATGAGGACTATAGG - Intergenic
1153571810 18:6480954-6480976 ATGTGTAACATGAGGACTATAGG + Intergenic
1154406634 18:14097795-14097817 ATGAAAAACATGAGCAGTATTGG - Intronic
1155591412 18:27431645-27431667 ATGTACAACATGAGAAATATAGG + Intergenic
1155678951 18:28466064-28466086 ATGTAGAGCATGATGACTATAGG - Intergenic
1155837330 18:30602429-30602451 ATGTACAACATGAAGACTAGAGG - Intergenic
1156893835 18:42220800-42220822 ATATATATCATGAGGACTATAGG - Intergenic
1156967413 18:43111657-43111679 ATGTATAGGATGAGGACTAGAGG - Intronic
1157999712 18:52603180-52603202 ATTTACAATAAGATGACTATAGG + Intronic
1158007424 18:52688559-52688581 ATGCACAACATGAGGACTATAGG + Intronic
1159253130 18:65908086-65908108 ATGGACAACTTGTAGACTATGGG + Intergenic
1159306220 18:66646505-66646527 GTGTACAACATGAGGACTATAGG - Intergenic
1159907314 18:74106841-74106863 ATGTCCAACATTAGGAGAATGGG + Intronic
1162198634 19:9005309-9005331 ATGTACAGCATGGTGACTATAGG + Intergenic
1164731629 19:30509743-30509765 ATGTGCAACATGAGAACTGTAGG - Intronic
1164875711 19:31685502-31685524 AAATAGAAAATGAGGACTATGGG - Intergenic
1165598249 19:37030020-37030042 TTATACAACATGAGGAGTATAGG - Intronic
928614215 2:33020281-33020303 CTATACAACATGAGGTCTATAGG + Intronic
931129102 2:59313336-59313358 GTGTACAGCATGAGAACAATGGG + Intergenic
932010449 2:67972410-67972432 ATGTACAACATTAAAACTAATGG + Intergenic
932687393 2:73883622-73883644 ATGTACACCCTGAGGACTATAGG + Intergenic
932954942 2:76340571-76340593 ATGTACAACATAAAGACTACAGG - Intergenic
933378903 2:81517708-81517730 AGGTACAACATGAGGGCTATAGG + Intergenic
934679810 2:96275380-96275402 ATGTAAAACTTGATGACCATAGG + Intronic
935037302 2:99390971-99390993 TTGAACAACATGAGGGCTAGGGG + Intronic
936626170 2:114151771-114151793 ATGTACAGCATGGAGACTATAGG - Intergenic
937074358 2:119090206-119090228 ATGAACAAGATGAGAACTAAGGG + Intergenic
938955679 2:136295858-136295880 ATGTACAACATGAGTATTGTAGG - Intergenic
939127346 2:138193322-138193344 CTGCAGAACATGAGGACTTTTGG - Intergenic
939440300 2:142240019-142240041 GGGAACAACATGAGGACTATAGG + Intergenic
939503302 2:143012766-143012788 ATGTACAGCATGAGGACTATGGG - Intronic
940062786 2:149591045-149591067 ATGTACAACATGAGAATTCTGGG - Intergenic
940972469 2:159908491-159908513 ATTTATAAAATGAGGATTATAGG - Intergenic
941435565 2:165466882-165466904 ATGTACAACATGAGGACTACAGG - Intergenic
942055211 2:172175927-172175949 AAATACAACATGAGGATTATAGG - Intergenic
942606989 2:177702590-177702612 AAGTGCAACATGAAGACTTTTGG + Intronic
942956029 2:181774321-181774343 ATGTTCTAAATGAGGACAATGGG - Intergenic
943166982 2:184341834-184341856 ATGTAAAGCATGAGGAATATAGG - Intergenic
943512794 2:188846962-188846984 ATGTACAACATGAGGACTACAGG + Intergenic
943687149 2:190830451-190830473 ATGTATAGCATGAGGACTATAGG - Intergenic
944359545 2:198836889-198836911 ATGTACACCATGAAGACTATAGG + Intergenic
945159929 2:206879184-206879206 ATGTACAACGTGAGGACTATAGG - Intergenic
947031573 2:225801714-225801736 ATTTTCAACATGAGTAATATTGG - Intergenic
947566397 2:231196687-231196709 ATGAACAACATGAGGCATACGGG - Intergenic
947820709 2:233067293-233067315 ACATACAACATGTGGACTTTGGG + Intronic
948081657 2:235210754-235210776 ATGAACAAGATGAAGACTTTTGG - Intergenic
1169504708 20:6196947-6196969 ATGTACATCATGGTGACAATAGG - Intergenic
1169976583 20:11335830-11335852 ATGAACAACATTAGGAGTTTAGG - Intergenic
1170509803 20:17064936-17064958 ATTTCCAACATGTGGACTTTGGG + Intergenic
1170724225 20:18911810-18911832 ATGTATAACACGAGGACTACAGG - Intergenic
1171541621 20:25962137-25962159 ATATACAACATGAGGACTATAGG + Intergenic
1171799444 20:29598212-29598234 ATATACAACATGAGGACTATAGG - Intergenic
1171844606 20:30258276-30258298 ATATACAACATGAGGACTATAGG + Intergenic
1174537600 20:51264121-51264143 ATGCAAAACATGGGGATTATGGG + Intergenic
1175492256 20:59387141-59387163 GTGCCCAACATGAGGACAATTGG - Intergenic
1175538480 20:59732631-59732653 ATGGCCAACATGAGGTCTAGAGG + Intronic
1176636598 21:9249572-9249594 ATGTACAACATGAGGACTGTAGG - Intergenic
1178114838 21:29406313-29406335 ATGTCAAATATGGGGACTATAGG + Intronic
1183126075 22:35783496-35783518 ACCTACAACATGAGGTCTACAGG + Intronic
949147492 3:720181-720203 ATGTCCAATATGTGCACTATAGG - Intergenic
949305200 3:2632191-2632213 ATGTACCAGATGAGCACTAGGGG - Intronic
949726207 3:7048783-7048805 TTGTACAGCATGGTGACTATAGG - Intronic
951065915 3:18265351-18265373 ATGTACAACATTAGAACCTTAGG + Intronic
951617473 3:24564012-24564034 ATATACAACATGAGAATTATAGG - Intergenic
955760889 3:62280929-62280951 ATATCCAACATGAGGACTACAGG + Intronic
957104165 3:75865692-75865714 ATGCACAACATGAGGACTGTAGG + Intergenic
957865855 3:86021903-86021925 ATACACAACATGAGAACTATAGG + Intronic
958593071 3:96185075-96185097 ATCTACAGCATGGTGACTATAGG + Intergenic
958626709 3:96635156-96635178 ATATACCACATGAAGACTATAGG - Intergenic
959089859 3:101890212-101890234 TTGTACAACAGGTGGATTATTGG + Intergenic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
965416222 3:168396476-168396498 AGGTAAAACATGAGGAGAATTGG - Intergenic
966319394 3:178684420-178684442 ATGTAAAACATGAGCACTATAGG + Intronic
971103102 4:23491193-23491215 ATGTACAACATGAGGGCTACAGG + Intergenic
971619961 4:28843784-28843806 ATGTACAACACGAGGACTGAAGG - Intergenic
972555321 4:40175480-40175502 ATGCAAAACATGAGAACTGTAGG + Intergenic
973024042 4:45244298-45244320 ATGTACAACATGAGATCTCTAGG - Intergenic
973144413 4:46806598-46806620 ATGTGCAGCATAATGACTATAGG - Intronic
973930415 4:55787988-55788010 ATTTACTTCATGAGGACAATTGG - Intergenic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
974264543 4:59567522-59567544 ATGTACAACATGAGGACTACAGG + Intergenic
974909665 4:68101901-68101923 ATGTACAACATGAGGACTATAGG - Intronic
975191478 4:71467886-71467908 ATGTATAACAATATGACTATGGG - Intronic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976508742 4:85882548-85882570 ATTTACAAAATGAGGAGCATGGG + Intronic
978001721 4:103562702-103562724 TTGTACAACATGAGTACTGATGG + Intergenic
978935408 4:114368761-114368783 ACATACAATATGAAGACTATAGG - Intergenic
979430910 4:120629248-120629270 ATGTAAAACATGAGGACTATAGG + Intergenic
981414543 4:144476327-144476349 ATGAACAACTTGAGGAGTCTAGG - Intergenic
981625951 4:146755536-146755558 ATGTACCACATAGGGACGATAGG + Intronic
981703773 4:147637510-147637532 TTGTACAACATGAGGATTTTAGG + Intronic
981836364 4:149059184-149059206 ATGTACAGCATGGTGACTACAGG - Intergenic
982132049 4:152238223-152238245 ATGTTCAACATGAGCACTAAAGG + Intergenic
982159297 4:152551931-152551953 ATGTTCAACATAAGAAATATTGG - Intergenic
982376835 4:154700829-154700851 ATGTACATCATGAGGAATACAGG + Intronic
982879686 4:160697155-160697177 TGGTACAACATGACGACTATAGG + Intergenic
984216710 4:176922278-176922300 AGGTACAACATGAGGACTATAGG - Intergenic
984745366 4:183210368-183210390 ATGTACAACATGAGGACTATAGG + Intronic
1202751486 4_GL000008v2_random:8011-8033 ATGTACAACATGAGGACTGTAGG - Intergenic
986849793 5:11797576-11797598 AAGTACATAATGAGGACGATGGG - Intronic
989181745 5:38584782-38584804 ATGTAAAAAATGGGGACTATAGG + Intronic
990229715 5:53699565-53699587 ATGTACAACATGAGAACTACAGG + Intergenic
992821492 5:80501507-80501529 ATGTGCAACATGAGGACTCCAGG + Intronic
992958796 5:81938419-81938441 ATGTAAAATATGAGGAGTAAGGG + Intergenic
993210325 5:84941349-84941371 ATGTACAACATGAGGAATATAGG - Intergenic
994381115 5:99072754-99072776 AGGTACAACATGAGGACTATAGG - Intergenic
995167115 5:109056643-109056665 ATTTACAACATGTGAACTATAGG + Intronic
995300389 5:110574149-110574171 ATGTAGAACATGAAGCTTATAGG - Intronic
996321844 5:122226405-122226427 ATGTACAGCAAGAGGACTATAGG + Intergenic
997065272 5:130552425-130552447 ATGTACAACATGAAGACTATAGG + Intergenic
998830589 5:146154112-146154134 TTGTACAATATGGTGACTATAGG + Intronic
999022402 5:148182380-148182402 ATATACAACATGAGAACTACGGG - Intergenic
999420955 5:151442702-151442724 AGGGACAACATAAGGACTATAGG - Intronic
999591969 5:153158293-153158315 ATGTACAGAATGGTGACTATAGG - Intergenic
999939389 5:156524654-156524676 ATATACAACATGGTGACTATAGG - Intronic
1000184458 5:158845659-158845681 ATGTACCCAATGAGAACTATAGG + Intronic
1000369777 5:160523690-160523712 ATGTACGACATGAAGACTCCTGG - Intergenic
1000680731 5:164180950-164180972 ACGTACAATATGGGGACTATAGG + Intergenic
1001127449 5:169033015-169033037 ATGTACAACCGGAAGACTATGGG - Intronic
1001161390 5:169318951-169318973 ATATCCAACATGAAAACTATAGG + Intergenic
1002464095 5:179396122-179396144 TTGTACAACATAATGAATATAGG + Intergenic
1003745037 6:8991236-8991258 ATGTACAACTTCAGGACTGTAGG + Intergenic
1004595741 6:17097843-17097865 CTGTTCAACAGGAGGGCTATAGG - Intergenic
1005733302 6:28720205-28720227 TTGTACAACATGATGACTATAGG - Intergenic
1007211889 6:40199131-40199153 ATGTACAACATGATGTTTGTAGG - Intergenic
1007567915 6:42867126-42867148 ATGCCCAACATGATGACAATGGG - Exonic
1008282310 6:49611460-49611482 ATGCACAGCATGAGGATTATAGG - Intronic
1008551989 6:52641471-52641493 ATGTACAGCATGGTGACCATAGG + Intergenic
1008871725 6:56280082-56280104 ATGTACAACTTGTGGATTGTAGG - Intronic
1009707405 6:67270269-67270291 ATGTGTAATACGAGGACTATAGG - Intergenic
1010006842 6:71004693-71004715 ATATACCACATGAGGACTATAGG - Intergenic
1010165354 6:72908283-72908305 ATGTACAACATGAGAACTAAAGG + Intronic
1010837217 6:80603851-80603873 ATGAACAACAAGAGGAATTTTGG - Intergenic
1011730397 6:90256800-90256822 ATGTGCAGTATGAAGACTATAGG - Intronic
1011890792 6:92156918-92156940 ATGCACAGCATAAGGACTGTAGG + Intergenic
1012502063 6:99899189-99899211 ATGTACAACATGAGGACTATAGG - Intergenic
1012532528 6:100255132-100255154 ATATACAACATGAGGAGGATGGG + Intergenic
1013729138 6:113142372-113142394 ATGTAAAACATAAGGAATCTGGG - Intergenic
1014289301 6:119539835-119539857 ATGGACAACAGGAGGACCAGTGG + Intergenic
1018946523 6:168350315-168350337 GTGTACAACATGAGGACTGCGGG - Intergenic
1019255060 7:44298-44320 ATGGACGACATAAGGACTGTTGG + Intergenic
1019255069 7:44363-44385 ATGGACAACACAAGGACTGTTGG + Intergenic
1019255095 7:44555-44577 ATGGACGACATAAGGACTTTTGG + Intergenic
1020588490 7:10103847-10103869 ACGTACAATATGAGGTCTATAGG + Intergenic
1020672325 7:11132165-11132187 ATATACAATATGAGGGCTACAGG - Intronic
1020832151 7:13106018-13106040 ATGGAAAGCATGAGGCCTATGGG - Intergenic
1021893263 7:25208650-25208672 ATGTACAACATGAGGACTGTAGG - Intergenic
1022312494 7:29210256-29210278 CTGTAAGACATGAGGACTGTTGG + Intronic
1023463650 7:40429202-40429224 ATGTACAACATAAATACTATAGG - Intronic
1024161099 7:46677285-46677307 ATGTACAACATGGTGGCTATAGG + Intronic
1025293056 7:57748339-57748361 ATATACAACATGAGGACTATAGG + Intergenic
1026364377 7:69633033-69633055 ATGTACAACATGAGGACTAAAGG - Intronic
1027613948 7:80398170-80398192 ATGTAAAACATTAGGATAATTGG - Intronic
1027637804 7:80697373-80697395 ATGCACAACATGAAGACAATGGG + Intergenic
1027977543 7:85178738-85178760 ATGTTAAACATGAAGACAATGGG + Intronic
1027991229 7:85363669-85363691 TTGTACAACATGATGACTGTAGG - Intergenic
1028409057 7:90508346-90508368 ATGTACTACATGAGTTCTTTAGG - Intronic
1028593017 7:92518533-92518555 ATGTACAACCTGACAACTATAGG - Intronic
1028878242 7:95848294-95848316 TTGTATAACATGATGACTATAGG - Intronic
1030388337 7:108893395-108893417 ACGTACAACATGACAACTCTAGG - Intergenic
1030811379 7:113976415-113976437 AGGTACAACAATAGGACAATGGG - Intronic
1030821685 7:114099850-114099872 ATATACAACATGAGGGTTTTGGG + Intronic
1031048488 7:116921031-116921053 ATGTACAACCAGTGGATTATAGG + Exonic
1031724930 7:125226676-125226698 ATGTATAGCATGAGGGCCATAGG - Intergenic
1031876701 7:127149957-127149979 ATGTACAACATGAAGGTCATAGG + Intronic
1032695468 7:134332222-134332244 ATGTACAACATGAGGACTATAGG - Intergenic
1033326977 7:140388006-140388028 TTGTACAATATGGTGACTATAGG - Intronic
1033938056 7:146613614-146613636 CTGTTCAATATGAGAACTATAGG + Intronic
1036134634 8:6149413-6149435 ATGTACAAGATGGGGAAAATGGG + Intergenic
1038042485 8:23736508-23736530 ATGAACAACGTAAGGACTATGGG - Intergenic
1038871575 8:31500527-31500549 ATGCACAAGATGAAGACTATAGG - Intergenic
1039140293 8:34379830-34379852 ATGTACAACATGGGCACTATAGG + Intergenic
1040421844 8:47247742-47247764 ATGTACAACATGAGGACTACAGG - Intergenic
1041565396 8:59272023-59272045 ATGTGCTGCATGAGGACTGTGGG - Intergenic
1044002368 8:86899247-86899269 ATATACGATATGAGGATTATAGG + Intronic
1044049073 8:87476967-87476989 ATGTATAACAGGAGGACTATAGG + Intronic
1044059264 8:87614439-87614461 ATGAACAACATTAAGAATATTGG + Intronic
1044145056 8:88702718-88702740 ATGTACTACTTGAGGACTATAGG - Intergenic
1045792726 8:106003883-106003905 ATGTACAACATGAGAACTACAGG + Intergenic
1045952483 8:107866963-107866985 CTGTGCAAAATGAGGACTGTGGG + Intergenic
1046125228 8:109898686-109898708 CTATACAACATGATGCCTATAGG + Intergenic
1046495215 8:115005348-115005370 ATATACCACATGAGGACTATAGG - Intergenic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1049126143 8:140790345-140790367 ATATACAAAATGAGGAATCTAGG + Intronic
1050762963 9:9096151-9096173 ATGTGCAACATGAGGACTATAGG + Intronic
1051005982 9:12345194-12345216 TTGTACATCATGATAACTATAGG + Intergenic
1051049518 9:12914622-12914644 AAGTACAACATGCATACTATAGG + Intergenic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1053413678 9:37932474-37932496 ATGCACAACACGAGGACCACAGG + Intronic
1054163477 9:61697560-61697582 ATATACAACATGAGGACTATAGG - Intergenic
1055727623 9:79248664-79248686 ATGGAAAAGATGTGGACTATGGG + Intergenic
1055870153 9:80867438-80867460 ATATACAACAGGAGGACTATAGG - Intergenic
1056429818 9:86516258-86516280 ATGTACAACATGGGGACTATAGG - Intergenic
1056516085 9:87351594-87351616 ATGTACAACATGATTTCTAGAGG + Intergenic
1057976932 9:99615276-99615298 ACATGCAACATGAAGACTATAGG + Intergenic
1058251348 9:102699480-102699502 ATGTACAGCATGAGAATTGTAGG + Intergenic
1058733360 9:107871605-107871627 ATGTACAACATGAGGACTATAGG - Intergenic
1059124941 9:111675439-111675461 ATGTTGAACATGGGGAATATGGG - Intergenic
1059141809 9:111860230-111860252 ATGTACAACATAAGGATTATAGG - Intergenic
1059148496 9:111924471-111924493 TTGTACAACATGGCAACTATAGG - Intronic
1059637968 9:116189198-116189220 ATGTATAGCATGAGGACTATAGG + Intronic
1059899137 9:118903255-118903277 ATATACAACATGAGGACTCTAGG + Intergenic
1060151387 9:121290785-121290807 ATGTGCAACATGAGGACTATAGG - Intronic
1203718937 Un_KI270742v1:185540-185562 ATGTACAACATGAGGACTGTAGG + Intergenic
1203653171 Un_KI270751v1:149215-149237 ATGTACAACATGAGGACTGTAGG + Intergenic
1187074781 X:15923358-15923380 ATGTATAGCATGGTGACTATAGG - Intergenic
1187377158 X:18765379-18765401 GTGTACAACACGAGGACTATAGG + Intronic
1187440601 X:19314989-19315011 ACGTATAGCATGATGACTATAGG - Intergenic
1187621125 X:21056410-21056432 GTGTACAACATGAGAACTATAGG - Intergenic
1188543603 X:31277241-31277263 TTGTACACCATGGTGACTATAGG - Intronic
1189169020 X:38891198-38891220 ATCTACAAAATGAGGATTATAGG + Intergenic
1189780523 X:44509942-44509964 ATCAACAACGTAAGGACTATAGG - Intergenic
1190124548 X:47692141-47692163 ATGTACAACATGAGGACTATAGG + Intergenic
1194178609 X:90685244-90685266 ATGTGCAACATGAGGAGTACTGG - Intergenic
1195929240 X:110057093-110057115 ATGTACAGCATGGCGACTATAGG - Intronic
1196051121 X:111305469-111305491 ATATAAAATATGAGGACTATAGG - Intronic
1196073854 X:111553111-111553133 ATCTAGAAGCTGAGGACTATAGG - Intergenic
1196160863 X:112480893-112480915 TTGTACATCATGAAGACTACAGG - Intergenic
1196361148 X:114861105-114861127 ATGTACAACATGTGGACGATAGG - Intronic
1196370471 X:114973565-114973587 ATGTAGAACATCAGGCTTATTGG - Intergenic
1196698677 X:118642172-118642194 ATGTACATCATGAGATCTAATGG - Intronic
1197179293 X:123517238-123517260 ATGTACATCATGAGTACTCTGGG + Intergenic
1198207477 X:134481175-134481197 ATGTACAACATGAAGTATATAGG - Intronic
1198416698 X:136427568-136427590 TTGTACAGCATGGTGACTATAGG - Intergenic
1200525273 Y:4267407-4267429 ATGTGCAACATGAGGAGTACTGG - Intergenic