ID: 1190135466

View in Genome Browser
Species Human (GRCh38)
Location X:47792577-47792599
Sequence GCATTAAATATGAAGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190135464_1190135466 -4 Left 1190135464 X:47792558-47792580 CCTCTGGAGCTAACAGCTTGCAT No data
Right 1190135466 X:47792577-47792599 GCATTAAATATGAAGGATCAAGG No data
1190135462_1190135466 12 Left 1190135462 X:47792542-47792564 CCTGAATATGTTCAAGCCTCTGG No data
Right 1190135466 X:47792577-47792599 GCATTAAATATGAAGGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190135466 Original CRISPR GCATTAAATATGAAGGATCA AGG Intergenic
No off target data available for this crispr