ID: 1190135945

View in Genome Browser
Species Human (GRCh38)
Location X:47798010-47798032
Sequence TCTGGGGTCCCTCAGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190135936_1190135945 8 Left 1190135936 X:47797979-47798001 CCCAGGGTACAAAACCCAGGGTG No data
Right 1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG No data
1190135937_1190135945 7 Left 1190135937 X:47797980-47798002 CCAGGGTACAAAACCCAGGGTGA No data
Right 1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG No data
1190135941_1190135945 -7 Left 1190135941 X:47797994-47798016 CCAGGGTGAGTTGCTTTCTGGGG No data
Right 1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG No data
1190135935_1190135945 9 Left 1190135935 X:47797978-47798000 CCCCAGGGTACAAAACCCAGGGT No data
Right 1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG No data
1190135933_1190135945 10 Left 1190135933 X:47797977-47797999 CCCCCAGGGTACAAAACCCAGGG No data
Right 1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG No data
1190135939_1190135945 -6 Left 1190135939 X:47797993-47798015 CCCAGGGTGAGTTGCTTTCTGGG No data
Right 1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190135945 Original CRISPR TCTGGGGTCCCTCAGCTGTG GGG Intergenic
No off target data available for this crispr