ID: 1190139419

View in Genome Browser
Species Human (GRCh38)
Location X:47829267-47829289
Sequence CTGAATATACAAACAGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190139419_1190139424 23 Left 1190139419 X:47829267-47829289 CCATTGCCTGTTTGTATATTCAG No data
Right 1190139424 X:47829313-47829335 TATATATCCTGCTGAGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190139419 Original CRISPR CTGAATATACAAACAGGCAA TGG (reversed) Intergenic
No off target data available for this crispr