ID: 1190143679

View in Genome Browser
Species Human (GRCh38)
Location X:47870972-47870994
Sequence ATGGGCAAATGGATTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2180
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 2137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190143679 Original CRISPR ATGGGCAAATGGATTAAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr