ID: 1190143913

View in Genome Browser
Species Human (GRCh38)
Location X:47873394-47873416
Sequence GCAGATTGAGGGAGTTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190143913_1190143922 16 Left 1190143913 X:47873394-47873416 CCCCTGAAACTCCCTCAATCTGC 0: 1
1: 0
2: 3
3: 31
4: 182
Right 1190143922 X:47873433-47873455 GCCAGTTGTTCCTTAGTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
1190143913_1190143927 28 Left 1190143913 X:47873394-47873416 CCCCTGAAACTCCCTCAATCTGC 0: 1
1: 0
2: 3
3: 31
4: 182
Right 1190143927 X:47873445-47873467 TTAGTGGAGGGTTTTCTCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 67
1190143913_1190143925 26 Left 1190143913 X:47873394-47873416 CCCCTGAAACTCCCTCAATCTGC 0: 1
1: 0
2: 3
3: 31
4: 182
Right 1190143925 X:47873443-47873465 CCTTAGTGGAGGGTTTTCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1190143913_1190143926 27 Left 1190143913 X:47873394-47873416 CCCCTGAAACTCCCTCAATCTGC 0: 1
1: 0
2: 3
3: 31
4: 182
Right 1190143926 X:47873444-47873466 CTTAGTGGAGGGTTTTCTCCGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1190143913_1190143920 12 Left 1190143913 X:47873394-47873416 CCCCTGAAACTCCCTCAATCTGC 0: 1
1: 0
2: 3
3: 31
4: 182
Right 1190143920 X:47873429-47873451 AATTGCCAGTTGTTCCTTAGTGG 0: 1
1: 1
2: 0
3: 15
4: 174
1190143913_1190143921 15 Left 1190143913 X:47873394-47873416 CCCCTGAAACTCCCTCAATCTGC 0: 1
1: 0
2: 3
3: 31
4: 182
Right 1190143921 X:47873432-47873454 TGCCAGTTGTTCCTTAGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190143913 Original CRISPR GCAGATTGAGGGAGTTTCAG GGG (reversed) Intronic
900561723 1:3310367-3310389 GCAGAGGGAGGGCGCTTCAGGGG - Intronic
901205076 1:7489930-7489952 GCAGATGGGGTGACTTTCAGCGG + Intronic
901248202 1:7750322-7750344 GCAGATACAGGGATTTTCTGGGG + Intronic
902989308 1:20175111-20175133 GCAGTTTCTGGCAGTTTCAGAGG - Exonic
906651659 1:47517143-47517165 GCAGAGTGAGGGAGATTCCCAGG + Intergenic
906871470 1:49486468-49486490 GCAGGTTGAGGGATTTTGATGGG - Intronic
910162809 1:84292166-84292188 GCATATTGGAAGAGTTTCAGGGG - Intergenic
912490790 1:110061570-110061592 GCAGGTTGTGGGGGTTTGAGGGG + Intronic
914917919 1:151829677-151829699 GCAGCTTGGGGGAGTCCCAGAGG - Intronic
915831323 1:159133532-159133554 GCAGATGGAGGGAGTTGCAGAGG - Intronic
916292339 1:163180638-163180660 GCAGCATGAGGGAATTTCTGGGG - Intronic
917329557 1:173868076-173868098 GAAGATTGAGGGAGGTTAGGGGG - Intronic
919939773 1:202278296-202278318 CCTGATTGAGAGATTTTCAGAGG + Intronic
920381439 1:205536729-205536751 GCAGATGGTGGGAGGTTCTGAGG - Intergenic
920830120 1:209457014-209457036 GCTGATTGAGGGGGTTAAAGTGG - Intergenic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
923533552 1:234830674-234830696 GCAGGTGGAGAGAGTTTCTGGGG + Intergenic
923948169 1:238914665-238914687 ACAGATTGAGGGAGAGTGAGGGG - Intergenic
1063391096 10:5650271-5650293 GCAGATAGACGGAGGTGCAGTGG - Intronic
1063585203 10:7346055-7346077 GAAGAATGAGGGAATTTCGGGGG - Intronic
1063852681 10:10210810-10210832 GCAGATTTAGAGAGTTTCTCAGG + Intergenic
1065187523 10:23183348-23183370 GGAGAGTGAGGGAGTTAGAGGGG + Intergenic
1070264488 10:74889141-74889163 CGAGATTGAGGAAGTGTCAGTGG + Intronic
1071163198 10:82776540-82776562 TCAGATTATGAGAGTTTCAGAGG - Intronic
1072482198 10:95819926-95819948 GCAAATTAAGGGCTTTTCAGGGG + Intronic
1072666126 10:97393768-97393790 CCAGATTGAGGGGGTTTGAATGG + Intronic
1072704452 10:97670546-97670568 GGAGATTGCGGGAGTATCTGGGG - Intronic
1073289498 10:102406335-102406357 GGACAGTGAGGGAGTCTCAGTGG + Intronic
1073394703 10:103208237-103208259 CCAGAGTGGGGGAGTTTCAAGGG - Intergenic
1073894018 10:108133020-108133042 GCAAGTTGAGGGAGTTACAGCGG + Intergenic
1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG + Intergenic
1075061202 10:119258088-119258110 GGAGTCTGGGGGAGTTTCAGGGG - Intronic
1079828592 11:25231761-25231783 GCAGAATGAGGTGGCTTCAGTGG - Intergenic
1079903851 11:26221510-26221532 GCAGATTGATGGAATCTCACAGG + Intergenic
1081758445 11:45560729-45560751 GGAGATTGAGGGAGTGGCAGAGG - Intergenic
1083663246 11:64261806-64261828 GCAGATCCAGGCAGTCTCAGGGG + Intronic
1087723109 11:101688915-101688937 GCAGAGTGAGTGAGTTAGAGTGG - Intronic
1089703767 11:120261798-120261820 GCAGATGGAGGGAATTTGGGAGG + Intronic
1090211891 11:124926693-124926715 AAAGAATGAGGGAGCTTCAGAGG - Intronic
1092709965 12:11325653-11325675 CTAAAATGAGGGAGTTTCAGTGG - Intergenic
1092710453 12:11331203-11331225 CTAAAATGAGGGAGTTTCAGTGG - Intergenic
1092714542 12:11375360-11375382 CTAAAATGAGGGAGTTTCAGTGG - Intronic
1092718252 12:11414379-11414401 CTAAAATGAGGGAGTTTCAGTGG - Intronic
1093906094 12:24693384-24693406 GCAGCTTGAGGCAGGTGCAGAGG - Intergenic
1094372192 12:29750620-29750642 GCAGAAAGAGGGAGTTTTAAGGG + Intronic
1095915465 12:47473859-47473881 TGAGATTAAGGGAGTTTAAGAGG + Intergenic
1096400286 12:51300193-51300215 GAAGAATGGGGGAGTCTCAGAGG + Intronic
1097468777 12:59961651-59961673 CCAGAAAGAGGGATTTTCAGAGG - Intergenic
1099088552 12:78277739-78277761 CCAGACTGAGGTAGTGTCAGAGG + Intergenic
1102825956 12:115948171-115948193 GCAAAGTGAGGGAGTGCCAGGGG + Intergenic
1103160534 12:118725505-118725527 GGAGATTGAGTGATTTTCTGAGG + Intergenic
1106368481 13:29107134-29107156 TCACATTGAGGGATTTTTAGAGG - Intronic
1106687108 13:32072024-32072046 GCAGATTCAGAGAGGTTAAGGGG - Intronic
1107977204 13:45701651-45701673 ACAAGTGGAGGGAGTTTCAGCGG + Intergenic
1111075233 13:83226993-83227015 GCTGAATGTGGGATTTTCAGGGG - Intergenic
1114083892 14:19223611-19223633 GCAAATTTGGGGAGTTTCAGTGG + Intergenic
1115745226 14:36429612-36429634 GCTGAAGGAGAGAGTTTCAGTGG + Intergenic
1117330911 14:54710989-54711011 GCATATTGAGGATGATTCAGAGG - Intronic
1118044163 14:61948539-61948561 GCATATTTGGGAAGTTTCAGAGG + Intergenic
1118590219 14:67395421-67395443 GCAGCTTGAAGGAGTTTCTCAGG + Exonic
1119063195 14:71497452-71497474 GTAGCATGAGGGAGTTTTAGGGG - Intronic
1119785011 14:77306499-77306521 GCAGCTGGAGGGAAGTTCAGAGG - Intronic
1119955389 14:78793389-78793411 GCAGATTGAGGGTGGTTTGGGGG - Intronic
1120082709 14:80233836-80233858 TTTGATGGAGGGAGTTTCAGTGG + Intronic
1120813630 14:88830348-88830370 CCACTTTGAGGGAGATTCAGAGG + Intronic
1202895497 14_GL000194v1_random:5353-5375 GCAAATTTGGGGAGTTTCAGTGG + Intergenic
1124362659 15:29049470-29049492 ACAGACTCAGGGAGTTTCAGGGG + Intronic
1124830017 15:33139261-33139283 GCTTATTGAGGAAGTTTCAAGGG + Intronic
1125484222 15:40101144-40101166 GCAGGTGGAGGGAAGTTCAGGGG + Intronic
1126162468 15:45626699-45626721 ACACATTGTGGGAGTTCCAGAGG - Intronic
1128306158 15:66600231-66600253 CCAGACTGAGGGAGGTGCAGGGG + Intronic
1131524689 15:93143500-93143522 TCAAATGGAGAGAGTTTCAGAGG - Intergenic
1133878267 16:9755983-9756005 GCAGATGGAATGAGTTTCAGAGG - Intronic
1134377849 16:13694900-13694922 ACAGCTTGAAGGAATTTCAGAGG + Intergenic
1138146750 16:54619457-54619479 GCAGGTTGAAAGAGTTTCATGGG + Intergenic
1139322994 16:66130412-66130434 ACAGACTGAGGGTGTGTCAGTGG - Intergenic
1143735917 17:8911964-8911986 GCATATTGAGGGAGTTGCTGTGG - Intronic
1146286170 17:31575431-31575453 GAAAAATGAGGGACTTTCAGGGG + Intronic
1146604782 17:34248987-34249009 GCAGAGAGAGTGATTTTCAGGGG - Intergenic
1148227676 17:45910327-45910349 TGAGATTCAGGGAGGTTCAGAGG + Intronic
1148498292 17:48068720-48068742 GCTAATTAAGGGAGTTTAAGTGG - Intergenic
1148759315 17:49991314-49991336 GCAGAGGGAGGGAGGTTCAGGGG + Exonic
1149643825 17:58224332-58224354 GCAGTGTGAGGGAATTTTAGGGG + Intronic
1149662510 17:58342310-58342332 GCAGATTGAGGGAGGTGAGGAGG + Intergenic
1153379821 18:4425797-4425819 TCATATTGGGGGAGTTGCAGGGG - Intronic
1153953078 18:10073304-10073326 GAAGATTAAGGGAATTTAAGTGG + Intergenic
1154027602 18:10723461-10723483 GCAGATGGAGGGAGATGTAGTGG + Intronic
1155260692 18:24039238-24039260 GGGAATTGAGGGAGTGTCAGAGG + Intronic
1157014317 18:43692364-43692386 GCAGAGTGAGTGAGTTACTGGGG - Intergenic
1157880783 18:51319359-51319381 GCAGATTCAAGGAGATACAGGGG + Intergenic
1159380508 18:67651386-67651408 GCAGACTCAGGGAGTGTCATAGG + Intergenic
1161614520 19:5262653-5262675 GCAGGCTGAGGGGGGTTCAGAGG - Intronic
1161685223 19:5699208-5699230 GCAGACAGAGGCAGGTTCAGTGG + Intronic
1163182693 19:15615493-15615515 GGAGATTCAGGGAATCTCAGGGG - Intronic
1164838234 19:31372623-31372645 GCATAGAGAGGGACTTTCAGAGG - Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
928643703 2:33328257-33328279 GAAGTTTGAGGGAGGTTCAGGGG - Intronic
929591760 2:43152539-43152561 AGAGAGTGAGGGAGTGTCAGAGG + Intergenic
929962601 2:46507811-46507833 ACAGATTGAGGGTGGCTCAGGGG + Intronic
931195508 2:60048836-60048858 GCAAATTGAGGGCATTTAAGTGG - Intergenic
932267088 2:70377149-70377171 GCAGATAGTGGGAGTCTAAGAGG + Intergenic
932611804 2:73205249-73205271 CCAAAGTGAGGGAGTTACAGGGG - Intronic
935246983 2:101227141-101227163 GAAGAATGAGGCAGCTTCAGTGG - Intronic
935255500 2:101306698-101306720 GAAGACTGAGGGAGATGCAGAGG - Intronic
937099274 2:119256261-119256283 GCAGAGCCAGGGAGATTCAGAGG - Intronic
937247235 2:120501671-120501693 GCAGATTCCAGGAGTTTCAGGGG - Intergenic
937718712 2:125064949-125064971 ACAGATTTGGGGAGCTTCAGGGG - Intergenic
938370639 2:130766260-130766282 CCAGATTGAGGCCGGTTCAGTGG - Exonic
938492697 2:131773049-131773071 GCAAATTTGGGGAGTTTCAGTGG - Intergenic
938884359 2:135628478-135628500 GCAGATAGTGGAAATTTCAGTGG + Intronic
939019132 2:136938221-136938243 GCAGATTGTGAGATTTTAAGGGG + Intronic
939098055 2:137858757-137858779 GAAGATTGAGGGGGTGGCAGTGG - Intergenic
943744427 2:191446634-191446656 GCACATTGAGGGGGTTTCCAAGG + Intergenic
945920611 2:215751305-215751327 GCAGATGGATGGAATTTAAGAGG - Intergenic
948870695 2:240796468-240796490 GGAGATTGGGGAAGTTTGAGGGG - Intronic
948875510 2:240825166-240825188 GCATATTGAGGCAGGTGCAGAGG - Intergenic
1168926383 20:1583707-1583729 ACAGATTGGGGGATTTTCAGGGG + Intronic
1168934652 20:1653681-1653703 ACAGATTGGAGGACTTTCAGTGG + Intronic
1168937821 20:1682148-1682170 ACAGATTGGGGGACTTTGAGGGG + Intergenic
1168940135 20:1703036-1703058 ACAGATTGGGAGAGTTTCAGTGG + Intergenic
1169937647 20:10901921-10901943 GCAGATTTAGGAACTTTAAGAGG - Intergenic
1170664838 20:18377975-18377997 GCATATAGAGGGAGTTTTTGGGG + Intergenic
1171970455 20:31561776-31561798 GCAAATAGAGGGACTTACAGAGG + Intronic
1172038284 20:32025824-32025846 GCAGACAGAGGGACTGTCAGAGG - Intronic
1172778259 20:37420478-37420500 CCAGATCGAGGTAGTTTCAAGGG + Intergenic
1172873738 20:38151689-38151711 CCAGCTTGAGAGAGTTACAGAGG + Intronic
1174910045 20:54597906-54597928 TCACATTGAGGCAGCTTCAGTGG - Intronic
1175507012 20:59493301-59493323 GCAGAATCATGGAATTTCAGAGG - Intergenic
1176615194 21:9021359-9021381 GCAAATTTGGGGAGTTTCAGTGG + Intergenic
1176710002 21:10142541-10142563 GCAAATTTTGGGAGTTTCAGTGG - Intergenic
1177779478 21:25607389-25607411 TCAAATGGAGTGAGTTTCAGAGG - Exonic
1177973107 21:27814794-27814816 GCAGATTCAGGAAATTTCTGTGG + Intergenic
1178160737 21:29911392-29911414 TCAGATTGAGGAAGATTCAGAGG + Intronic
1180294082 22:10869652-10869674 GCAAATTTGGGGAGTTTCAGTGG - Intergenic
1180496888 22:15899076-15899098 GCAAATTTGGGGAGTTTCAGTGG - Intergenic
1181418769 22:22781841-22781863 GCAGTTTTGGGGAGTGTCAGTGG + Intronic
1182033642 22:27180793-27180815 GCAGCTGTAGGGAGCTTCAGAGG + Intergenic
1183949924 22:41347203-41347225 GCAGATTGAGGGCCTGTCCGGGG + Intronic
949427207 3:3930379-3930401 GGAGATAGAGTGTGTTTCAGGGG + Intronic
952083677 3:29792424-29792446 GAAAATTCAGTGAGTTTCAGAGG - Intronic
952626074 3:35405113-35405135 TCAGATTCAGGGAGTTTAAGTGG - Intergenic
953578251 3:44130192-44130214 GAAGATGGAGGCAGTTTCAATGG + Intergenic
953764095 3:45721110-45721132 GCATATTCATGGAGTTACAGAGG + Intronic
953844405 3:46415959-46415981 GCAGGTAGAGGGAGTTCCAAAGG - Intergenic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
955889058 3:63631378-63631400 GGAGATTGAGGGAGAATAAGGGG - Intergenic
960522621 3:118673090-118673112 GGAGTTTGAGGGATTTTAAGTGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
968835402 4:2960303-2960325 GCAGAGGGAGGGAGTGTCACTGG + Intronic
971306174 4:25483560-25483582 GCGGATTGGGTGAGTGTCAGGGG - Intergenic
972023113 4:34339953-34339975 AGAGATTGAAGGAGATTCAGAGG + Intergenic
973276549 4:48316118-48316140 GCAGATTGTGAGAGTTTCCAGGG - Intergenic
978018563 4:103779482-103779504 GAAGAGTGAAGGAGTTTCTGTGG - Intergenic
978227359 4:106353209-106353231 GGAGATTGGAGGAGCTTCAGAGG - Intergenic
978724996 4:111959271-111959293 GAAGCTTGAGGGAGTTGTAGAGG + Intergenic
981316229 4:143342511-143342533 GCAGACTGAGAAAGTTTCAGAGG + Intronic
982318887 4:154058945-154058967 CCAGAGTGAGGGAGTTTTAAGGG - Intergenic
983306543 4:165996702-165996724 GAAGATTGTGAGACTTTCAGGGG + Intronic
983987613 4:174079157-174079179 GCAGAGTAAGGGAGATTGAGAGG - Intergenic
987060089 5:14234207-14234229 GGAGATAGTGGTAGTTTCAGAGG + Intronic
995008203 5:107227047-107227069 GCAAATGGAGGGAGTTGTAGGGG - Intergenic
995222940 5:109671495-109671517 GCAGATTGAGGCAATCTTAGAGG + Intergenic
995531359 5:113094981-113095003 GTAGACTGAGGGAGTTTTAGGGG - Intronic
998631921 5:143908247-143908269 GCAGACTGAGGGACTTTTAGTGG + Intergenic
1000043869 5:157505563-157505585 GAAGTTTAAGGGAGTCTCAGTGG + Intronic
1003099814 6:3168533-3168555 CCAGAGTGGGGGAGTTTTAGGGG - Intergenic
1003383388 6:5645583-5645605 GCACACAGAGGAAGTTTCAGAGG - Intronic
1004183145 6:13397933-13397955 GAAGATAGAGGGAGTATCTGGGG - Intronic
1004388992 6:15194098-15194120 GCAGCTTGAGGGAGTCTCATAGG - Intergenic
1007955917 6:45917727-45917749 GCAGATTGAGCCAGGGTCAGAGG - Intronic
1009309571 6:62133740-62133762 GCAGACTGAGGTAGTCTCAGAGG + Intronic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1011416952 6:87131917-87131939 GCAGTTTGAGGGAATTTCTTGGG - Intergenic
1012759945 6:103287316-103287338 GGAGATTCAGCAAGTTTCAGGGG + Intergenic
1014029819 6:116687416-116687438 GCAGCTTGAGGGAGTTTTAGGGG + Intronic
1015560720 6:134512425-134512447 GCAGAATGAGCGAGATCCAGGGG + Intergenic
1017229211 6:152054244-152054266 GCAGAAAGAGGGAAATTCAGAGG - Intronic
1017914477 6:158820524-158820546 GCAGATCCAGGGCATTTCAGAGG + Intergenic
1020051319 7:5083833-5083855 GTGGATTGAGTGAGTTGCAGTGG - Intergenic
1026268791 7:68818617-68818639 GCATGGTGAGGGAGTTTCTGGGG + Intergenic
1027048375 7:75006348-75006370 GCAGCATGAGAGAGTTCCAGTGG + Intronic
1029127710 7:98306182-98306204 GCACAGGGAGGGAGTTTCAGAGG + Intronic
1029272756 7:99386655-99386677 GGAGATGGAGGGAGATTGAGGGG - Intronic
1036549742 8:9805608-9805630 CCAGAGTGAGGGAGTTTTAAGGG - Intergenic
1036670793 8:10785976-10785998 CCAGATTAAGGGAGTTTATGTGG + Intronic
1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG + Intergenic
1038858803 8:31362777-31362799 GCAGATTGAGGGAGACTCCAGGG + Intergenic
1041958009 8:63577757-63577779 GGACAGTGAGGGAGTTTCAAGGG + Intergenic
1043867392 8:85391386-85391408 GTAGAAGGAGGGAGTTTCAGAGG - Intronic
1044138812 8:88621705-88621727 GCAGGCAAAGGGAGTTTCAGGGG - Intergenic
1045753423 8:105513062-105513084 TCACAATGAGTGAGTTTCAGTGG + Intronic
1047566556 8:126050105-126050127 GAAGATAGAGGAAGTTTTAGAGG + Intergenic
1048610181 8:136014126-136014148 GCAGTTTGGGGAAGTGTCAGTGG + Intergenic
1050058424 9:1679495-1679517 GCAGATTCAGGGAGTTTAGGGGG + Intergenic
1052990763 9:34518275-34518297 GCAGTTTGAGGCAGTGGCAGGGG + Intronic
1053646979 9:40128234-40128256 GCAAATTTGGGGAGTTTCAGTGG - Intergenic
1053758746 9:41335608-41335630 GCAAATTTGGGGAGTTTCAGTGG + Intergenic
1054327981 9:63726199-63726221 GCAACTTTGGGGAGTTTCAGTGG - Intergenic
1054537600 9:66247936-66247958 GCAAATTTGGGGAGTTTCAGTGG + Intergenic
1057567299 9:96176946-96176968 GCATATAGAGGGAGGTTTAGGGG + Intergenic
1057609918 9:96532569-96532591 ACAGATCGTGGGAGTTCCAGAGG - Intronic
1057648974 9:96903177-96903199 GCAGCATGAGGGAGTTTCTTAGG - Intronic
1058261909 9:102844303-102844325 GGAGATTGAGGGAGATTTGGAGG - Intergenic
1060421711 9:123473789-123473811 GGAGATTTAGGGACTTTTAGTGG - Intronic
1062595332 9:137296555-137296577 GCAGGCTCAGGGAGCTTCAGGGG + Intergenic
1202794763 9_KI270719v1_random:111538-111560 GCAAATTTTGGGAGTTTCAGTGG - Intergenic
1188327751 X:28826910-28826932 GCATATTCAAGTAGTTTCAGAGG + Intronic
1188865102 X:35304841-35304863 CCAGGTTGAGGTAGTCTCAGAGG + Intergenic
1190066201 X:47243336-47243358 GCAGAGTCAGGGAGTCTCTGGGG + Intronic
1190143913 X:47873394-47873416 GCAGATTGAGGGAGTTTCAGGGG - Intronic
1191842762 X:65524826-65524848 GAAGGCTGAGGGACTTTCAGAGG + Intronic
1193794051 X:85851679-85851701 GCAGGTAGAGGAATTTTCAGAGG + Intergenic
1194747035 X:97639701-97639723 GGAGCCCGAGGGAGTTTCAGTGG + Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1197985452 X:132262093-132262115 GCCCATTGAGGGAGCTTTAGGGG - Intergenic
1198286648 X:135197662-135197684 GCAGATTAAGGGAGGTTCAGGGG - Intergenic
1199363575 X:146951022-146951044 GCAGACTTAGGGAGATTCACAGG - Intergenic