ID: 1190144821

View in Genome Browser
Species Human (GRCh38)
Location X:47880921-47880943
Sequence GACTCTGCAGGGTCCTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 23, 2: 30, 3: 108, 4: 363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190144808_1190144821 23 Left 1190144808 X:47880875-47880897 CCTAGGTCAAGGGACCACATCTG 0: 8
1: 24
2: 98
3: 184
4: 472
Right 1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG 0: 1
1: 23
2: 30
3: 108
4: 363
1190144817_1190144821 -7 Left 1190144817 X:47880905-47880927 CCTTCTCATTGGTGGGGACTCTG 0: 1
1: 0
2: 8
3: 95
4: 427
Right 1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG 0: 1
1: 23
2: 30
3: 108
4: 363
1190144812_1190144821 9 Left 1190144812 X:47880889-47880911 CCACATCTGGTGAGGGCCTTCTC 0: 2
1: 57
2: 153
3: 245
4: 394
Right 1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG 0: 1
1: 23
2: 30
3: 108
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190144821 Original CRISPR GACTCTGCAGGGTCCTGAGG TGG Intronic
900691031 1:3980705-3980727 GAGTGTGCAGGGTCGTGGGGAGG + Intergenic
902839499 1:19066157-19066179 GACTGTGCTGAGTCCTGGGGAGG - Intergenic
902923799 1:19682779-19682801 GACTCTGCAGGTCTCTGATGAGG + Exonic
903858288 1:26350191-26350213 TTCTCTGCAGAGTCCCGAGGGGG - Intronic
904622339 1:31782921-31782943 GACTGAGCAGGCTTCTGAGGGGG + Intergenic
906124789 1:43421118-43421140 GACTCTGCTGGGTGCAGATGAGG - Intronic
906617730 1:47246047-47246069 GACTCTGCAGAATCCTGAGGTGG + Intergenic
907320534 1:53599412-53599434 ACCTCTGCAGAGTCCCGAGGTGG - Intronic
907651165 1:56296158-56296180 ATCTCTGCAGGGTGCTGAAGGGG - Intergenic
908303927 1:62791554-62791576 GATTCTGCAGAGTCCTGAGGTGG + Intronic
908700645 1:66896713-66896735 GACTCTGCAGAGAGCTGAGGTGG - Intronic
910312356 1:85838626-85838648 GTCTCTGTAGGGTCCAGTGGGGG - Exonic
911092222 1:94026723-94026745 GAATGTGGTGGGTCCTGAGGTGG - Intronic
911370127 1:96986620-96986642 GACTTGGCTGTGTCCTGAGGAGG + Intergenic
911389424 1:97220308-97220330 CTCTCTGGAGAGTCCTGAGGTGG - Intronic
911556415 1:99350612-99350634 GACTCTGCAGAGTCCCAAGGTGG + Intergenic
912431950 1:109632686-109632708 GGCTGTGCAGGGTCCTGGGTGGG + Intergenic
913077321 1:115352146-115352168 GACCCTGGAGGAACCTGAGGAGG - Intergenic
913202448 1:116506185-116506207 AACTCTGTAGAGTCCTGAGGTGG + Intergenic
914981592 1:152419359-152419381 GACTTTGTAGGGTTCTGAGAAGG - Intergenic
915981868 1:160425404-160425426 AACTCTGGGGGGTCCTGAGGGGG + Exonic
916782824 1:168054291-168054313 GACTCTGCAGAGTCCCGAGCTGG + Intronic
916793414 1:168144169-168144191 CTCTCTGCAGAGTACTGAGGTGG - Intergenic
917152716 1:171962006-171962028 CTCTCTGCAGAGTCCTGAGGTGG + Intronic
918200735 1:182264176-182264198 CTCTCTGTGGGGTCCTGAGGTGG - Intergenic
918251633 1:182708344-182708366 GACACTGCAGGGGCCAGCGGGGG - Intergenic
918545906 1:185683660-185683682 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
918781482 1:188705253-188705275 CTTTCTGCAGAGTCCTGAGGTGG + Intergenic
918962912 1:191303361-191303383 GAATCTGCAGGGACCCCAGGTGG - Intergenic
919510483 1:198457294-198457316 GATTCTGGAGAGTCCTGAGGTGG + Intergenic
920228197 1:204453100-204453122 GACTGAGGAGGGTCCTGGGGAGG - Intronic
920554222 1:206892291-206892313 GACTCTGCAGAGTCCCGAGGTGG + Intergenic
920584708 1:207146351-207146373 GACTTTGCAGGGGCCCAAGGTGG - Intergenic
921183959 1:212654430-212654452 GACACTGAAGGTTCTTGAGGAGG + Intergenic
921683640 1:218064468-218064490 GACGCTGCAGAATCCTGACGTGG + Intergenic
1062902732 10:1158029-1158051 GGTTCTGCAGAATCCTGAGGTGG - Intergenic
1064472471 10:15650520-15650542 CCCTCTGCAAAGTCCTGAGGTGG - Intronic
1066010991 10:31193220-31193242 GTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1066997585 10:42578138-42578160 GGCTCTGCAGGGTCCCAGGGAGG - Intronic
1067017981 10:42771887-42771909 AAGTCTGGAGGGTGCTGAGGTGG - Intergenic
1067142001 10:43666161-43666183 GACTCTGCAGAGCCCAGAGGTGG + Intergenic
1068121338 10:52784868-52784890 GGCTTTGCAGGGTCCTGAGTGGG + Intergenic
1070202718 10:74223181-74223203 GACTCTACAGATTCCTGAGGTGG + Intronic
1070785848 10:79161924-79161946 GACTCTGAAGGGACATGATGGGG - Intronic
1071957815 10:90778431-90778453 GACTCTGCAGAGTCCCCAGGTGG - Intronic
1072025583 10:91452663-91452685 GACTCTGCAAAGTCCTGAGGGGG - Intronic
1072483289 10:95829993-95830015 CTCTCTGCAGAGTCCCGAGGTGG - Intronic
1073225810 10:101917861-101917883 GATGCTGCAGGGTGCTGATGAGG - Intronic
1073511220 10:104043742-104043764 GACTCTGCAGCGTTCTGGGCAGG - Intronic
1073668861 10:105564735-105564757 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1073930200 10:108566664-108566686 GACTCCGCAGGGTCCAGCCGTGG + Intergenic
1074288011 10:112116486-112116508 CACTGCGCTGGGTCCTGAGGAGG + Intergenic
1074420321 10:113302824-113302846 GACTCTGCAGGGAAGTTAGGAGG - Intergenic
1075379559 10:122007969-122007991 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
1075398773 10:122146593-122146615 GACTCTGCAGAGTACAGAGGTGG - Intronic
1076229256 10:128806598-128806620 GATTCTGCAGCCTCCTGGGGGGG - Intergenic
1076451032 10:130557114-130557136 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1076803267 10:132842772-132842794 GCCTCTGCAGAGTCCTGAGGTGG + Intronic
1076903022 10:133349053-133349075 GTCTCTTCAGGGCCCTGCGGGGG - Intronic
1077114647 11:878034-878056 GACTCCGAAGAGTCCGGAGGTGG - Intronic
1077900007 11:6480451-6480473 GGCTTTGCAGGGTGCTGGGGTGG - Intronic
1078073161 11:8132369-8132391 GACTCTGAAGGCTTTTGAGGAGG - Intronic
1078931115 11:15912772-15912794 CACTCTGCAGGGGCCTGTGCTGG - Intergenic
1079685768 11:23357699-23357721 AACTCTGCAAAGTCCTGAGGTGG + Intergenic
1079875827 11:25856098-25856120 GACTCTGCAGAGTCCAGAGATGG - Intergenic
1080120974 11:28676759-28676781 TAATATGCAGGGTTCTGAGGAGG + Intergenic
1081534988 11:43989850-43989872 CTCTCTGCAGGACCCTGAGGAGG - Intergenic
1082872775 11:57958877-57958899 CACTCTGCAGGGTCCCTAGGTGG - Intergenic
1083281149 11:61628071-61628093 GGCTCCCCAGGGGCCTGAGGAGG + Intergenic
1084568345 11:69944279-69944301 CACCCTGCAGGCTCCTGAGCAGG - Intergenic
1085045286 11:73349133-73349155 GACATGGCAGGGGCCTGAGGGGG + Intronic
1085233597 11:74993760-74993782 GACTCTGCAGAGTCTGGAGGTGG + Intronic
1085400138 11:76230899-76230921 GACTTTTCTGGGTCCTGAGCTGG + Intergenic
1085449862 11:76625275-76625297 CTCTGTGCAGGTTCCTGAGGAGG - Intergenic
1085458890 11:76681257-76681279 GAAGATGCAGGGTCCTGAGACGG + Intergenic
1085800035 11:79580813-79580835 CTCTCTGCAGGGTCCTGAGGTGG - Intergenic
1086576403 11:88343033-88343055 GACTCTCCAGAGTCTAGAGGTGG + Intergenic
1086935749 11:92743902-92743924 GACTCTGGAGAGTTGTGAGGTGG - Intronic
1088670739 11:112137919-112137941 CATTCTGCAGGCTCCTCAGGAGG + Intronic
1088972375 11:114785153-114785175 GGCACTGTAGGGTCCTGAAGTGG + Intergenic
1089067226 11:115670960-115670982 GACTTCACAGGGTCCTTAGGTGG + Intergenic
1089329929 11:117682122-117682144 TACACAGCAGGGTGCTGAGGAGG - Intronic
1089697955 11:120227403-120227425 GACTCTGCTAGGCCCTGTGGAGG + Intronic
1089904822 11:122027820-122027842 GACCCTGCAGAGTCCTGAGGTGG + Intergenic
1090047413 11:123348183-123348205 CTTTCTGCAGGGTCCTAAGGTGG - Intergenic
1090565614 11:127988806-127988828 GCCTCTGCAGAGTCCCAAGGTGG - Intergenic
1091091299 11:132773496-132773518 GTCTCTGCAGGTTCCTGGTGAGG + Intronic
1091191631 11:133700314-133700336 ACCTCTGCAGAGTCCTGAGGTGG - Intergenic
1091303876 11:134524294-134524316 GCCGCCGCAGGGTCCTGAGGCGG - Intergenic
1091747275 12:3000396-3000418 AACTCTGCAGAGTCCCGAGGTGG + Intronic
1094649269 12:32359400-32359422 GACTCTGCAGAGTCCCAAAGTGG + Intronic
1094738416 12:33260745-33260767 GACTTTGAAGGGTCCAGGGGTGG + Intergenic
1094744174 12:33324637-33324659 GACTCTGCAGAGTCTGGAGGCGG + Intergenic
1094751743 12:33417397-33417419 GACTCTGCAGAGTCCCAAGGTGG - Intronic
1094771415 12:33664993-33665015 GACTCTGCAGAGTCCCAAAGTGG - Intergenic
1095051080 12:37554769-37554791 GACCCTGAGGGGGCCTGAGGAGG + Intergenic
1095054397 12:37582356-37582378 GACCCTGAAGGGACCTGAAGGGG + Intergenic
1095972137 12:47909594-47909616 TCCCCTGCAGGGTTCTGAGGGGG - Intronic
1100024712 12:90113925-90113947 CTCTCTGCAGAGTCCTGAAGTGG + Intergenic
1100965081 12:100004330-100004352 GACTCAGCAGAGTCGTGAGATGG - Intergenic
1101201126 12:102437247-102437269 TCCTCTGCAGAGTCCCGAGGTGG - Intronic
1101311706 12:103586732-103586754 GCATCTTCAGGGTCCTGTGGAGG + Intergenic
1101487928 12:105184711-105184733 GACTCTGGTGGTTCCTGACGGGG - Intronic
1101989304 12:109471365-109471387 CACTCTGCAGGGCCCTGACATGG - Intronic
1102046285 12:109832286-109832308 GACTCCCCGGGCTCCTGAGGAGG - Intronic
1102217086 12:111169286-111169308 CACTCTGCAGGCTCCAGGGGAGG - Intronic
1103479953 12:121244525-121244547 GCCTCTGCTGGGGCCTGAGGGGG - Intronic
1104323406 12:127773247-127773269 AACTATGCAGGGAGCTGAGGTGG + Intergenic
1104648951 12:130517277-130517299 GACTCTGTAGGGTCCCAAGGTGG - Intronic
1105342333 13:19538996-19539018 GACTCTACAGAGTTCTGAAGTGG + Intergenic
1105793966 13:23832265-23832287 GACTCTGCAGAGTCCCAAGGTGG - Intronic
1105845475 13:24290424-24290446 GCTTCAGCAGGCTCCTGAGGGGG - Intronic
1106464620 13:30001953-30001975 CTCTCTGCAGAGTCTTGAGGTGG + Intergenic
1106950018 13:34872946-34872968 CCCTCTGCAGAGTCCTGAAGTGG + Intergenic
1107475151 13:40728605-40728627 AGCTCTTCAGGGGCCTGAGGTGG - Intergenic
1108230262 13:48331541-48331563 GAGTCCTCAGAGTCCTGAGGTGG - Intronic
1109444400 13:62414194-62414216 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1111583102 13:90250028-90250050 GGCTCTAAAGGGTACTGAGGAGG - Intergenic
1112266801 13:97931890-97931912 GACTCTGCAGAGTCCCAAGGCGG + Intergenic
1112572714 13:100608331-100608353 AACTCTGCAGGGTGAGGAGGAGG + Intronic
1113154418 13:107302187-107302209 GGCTCTGCAGAGTCCCCAGGTGG - Intronic
1113210376 13:107971526-107971548 TACTCTGCAGTTTCCTAAGGAGG - Intergenic
1113285225 13:108839110-108839132 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1118595794 14:67434874-67434896 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1118716393 14:68563102-68563124 GACTCTGCCGGGTTCAGAGAGGG + Intronic
1119069897 14:71572031-71572053 GACTCTGCAGCATCCCGAGAAGG + Intronic
1119590653 14:75884434-75884456 AACTCTGCAGCCTCCTGAGATGG + Intronic
1121065411 14:90959309-90959331 GACTCTGCAGAGTTCTGAGTAGG + Intronic
1121106026 14:91280222-91280244 TCTTCTGCAGGCTCCTGAGGTGG - Intronic
1121697296 14:95924256-95924278 GACTTTTCAGGGACATGAGGAGG + Intergenic
1121714676 14:96065139-96065161 GAGGCTGCAGGGTTCTGAGCCGG + Intronic
1121753118 14:96375815-96375837 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1122374963 14:101251431-101251453 GACTCTGGAGTGTGGTGAGGAGG + Intergenic
1122627956 14:103093907-103093929 GCTGCTGCAGGGTGCTGAGGTGG - Intergenic
1122771312 14:104099183-104099205 GAGCCTGCAGGGACCTGAGGAGG - Intronic
1122972303 14:105157322-105157344 GGCTCTGCAGGGCCCTGCAGGGG - Intronic
1122996260 14:105266678-105266700 GACTCAGCATGGTCCTGGGGAGG - Intronic
1124438335 15:29669413-29669435 GACTCTGTAGAGTCCCAAGGTGG - Intergenic
1124686358 15:31786112-31786134 GACTCTGCAGAGTCCCCAGGTGG - Intronic
1126518324 15:49559207-49559229 GACTCTGCAGGGAGTTGAGATGG - Intronic
1128219659 15:65959205-65959227 GACTCTGTTGGGCCCTGAGAAGG - Intronic
1130098991 15:80877665-80877687 GACCCAGCAGTGTCCTGAGGTGG - Intronic
1130747757 15:86674389-86674411 AACTCTGCTGAGTGCTGAGGAGG + Exonic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1132524181 16:406169-406191 TACTCTGGAGGGACCTCAGGTGG - Intronic
1132676955 16:1124865-1124887 CACCCAGCAGGGTCCTGAGTGGG + Intergenic
1132959462 16:2613867-2613889 GCCTCTGAAGCCTCCTGAGGTGG + Intergenic
1132972523 16:2695842-2695864 GCCTCTGAAGCCTCCTGAGGTGG + Intronic
1133246180 16:4450381-4450403 GACTCTGCTCGGTCCACAGGAGG + Exonic
1133809408 16:9149519-9149541 CTCTCTGCAGAGGCCTGAGGTGG + Intergenic
1134189344 16:12109245-12109267 CTCTCTGCAGGGTCCTGAACTGG + Intronic
1134761530 16:16719003-16719025 GATTCTGTAGGTCCCTGAGGGGG - Intergenic
1134984528 16:18640167-18640189 GATTCTGTAGGTCCCTGAGGGGG + Intergenic
1135204808 16:20474434-20474456 GACTCCGCAGAGTCCCAAGGAGG - Intronic
1135214089 16:20549379-20549401 GACTCTGCAGAGTCCCAAGGAGG + Intronic
1135561355 16:23479292-23479314 GAATCAGCAGGGTTCTGAGTAGG - Intronic
1136902289 16:34051584-34051606 GAGGCTCCAGGGTCCTGTGGAGG + Intergenic
1138301335 16:55932218-55932240 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
1138323652 16:56142049-56142071 GACTCTGAAGCGTCCAAAGGTGG + Intergenic
1138493310 16:57390866-57390888 GCCTCTGCAGAGTCCCAAGGTGG - Intergenic
1138533870 16:57649460-57649482 GACTCTGGAGGGAGTTGAGGAGG + Intronic
1139381405 16:66534179-66534201 GACTCTTCAGAGTCCCCAGGTGG - Intronic
1139430323 16:66907673-66907695 GTCTCTGCAGGGCCCTGGGCAGG - Intergenic
1139515659 16:67451047-67451069 GGGTCTGCAGGGTGCTGAGTAGG + Intronic
1140330275 16:74049679-74049701 GACTTGGCAGGGGCCAGAGGGGG - Intergenic
1140970576 16:80008611-80008633 CTCTCTGCAGAGTCCTGAGATGG - Intergenic
1140970687 16:80009674-80009696 GAATCTGCACAGTCCTCAGGTGG - Intergenic
1141183809 16:81772932-81772954 CAGTCTGCAGGGTCCTGCAGTGG - Intronic
1141434314 16:83990643-83990665 GACCCTGCAGGGTCCCATGGGGG + Intronic
1141439682 16:84021867-84021889 GACTTTGCAGAGCCCTGAAGTGG + Intronic
1141611808 16:85185841-85185863 AACTCTGGAGGGCCCTGCGGGGG + Intergenic
1142932277 17:3297007-3297029 ATCTCTGCAGGGCCCAGAGGGGG - Intergenic
1143781909 17:9233509-9233531 GACAATGCAGGGTCCTCAGAAGG + Intronic
1144347817 17:14365879-14365901 GACTCTGCAGAGTTCCAAGGAGG + Intergenic
1144353308 17:14420230-14420252 GGCCCTGCAGGCTCTTGAGGTGG - Intergenic
1145374936 17:22338419-22338441 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1147562659 17:41518652-41518674 GTCTCTTCAGGGTCAGGAGGAGG - Exonic
1147770881 17:42867150-42867172 GCCTCTGGAGGGTCCTGGTGTGG - Intergenic
1148165495 17:45481620-45481642 AGCTCTGGAGGGTCCTGGGGTGG + Intronic
1148581210 17:48745247-48745269 GGGTCTGCAGGGAGCTGAGGGGG - Intergenic
1148776633 17:50099350-50099372 GACTCTGCAGGGGCCCCTGGGGG - Intronic
1148853780 17:50567563-50567585 GACTCTGTAGGGCCCAGAGCAGG - Intronic
1149206643 17:54255113-54255135 CTCTCTGAAGAGTCCTGAGGAGG - Intergenic
1149632650 17:58139654-58139676 GACTCTGAGGAGTCCTGAGGTGG + Intergenic
1150396722 17:64828336-64828358 AGCTCTGGAGGGTCCTGGGGTGG + Intergenic
1150837120 17:68574305-68574327 TCCTCTGCAGAGTTCTGAGGTGG + Intronic
1151286366 17:73114439-73114461 GACTCTGCAGAGTCTTGAAGTGG - Intergenic
1152876799 17:82790923-82790945 GGCTTTGCAGGGACCTGAAGGGG - Intronic
1153916850 18:9753423-9753445 GACTCTGTAGAGTCCCAAGGTGG - Intronic
1155163014 18:23210826-23210848 GTTTCTGCAGGGGCCAGAGGAGG - Intronic
1157023722 18:43817432-43817454 GACTCTGAAGAGTCCTGAGGTGG - Intergenic
1157339168 18:46764103-46764125 GACTCTTCAGGGAAATGAGGTGG - Intergenic
1159932833 18:74332208-74332230 CTCTCTGCTGAGTCCTGAGGTGG + Intronic
1160196053 18:76756548-76756570 GACTCCTTAGGGGCCTGAGGTGG + Intergenic
1160607900 18:80066076-80066098 GAGTGTGCAGGGTCCTGGGTGGG + Intronic
1160686592 19:439542-439564 AAGTCTACAGGGTCCTGAAGGGG + Intronic
1161808775 19:6459698-6459720 GACCCTGCGGGGTCCCGGGGGGG - Exonic
1161914882 19:7221044-7221066 GACTCTGCAGAGTCCTGACAGGG - Intronic
1162427172 19:10603470-10603492 GACACTGAAGGGCCCTGGGGAGG + Intronic
1162608027 19:11726630-11726652 GACTCTGCAGAGTCCCTAGGTGG - Intronic
1162678902 19:12323536-12323558 GACTCTGCAGAGTTCTTAGATGG - Intronic
1162686881 19:12394242-12394264 GACTCTGCAGAGTCCCTAGGCGG - Intronic
1162691228 19:12434024-12434046 GACTCTGCAGAGTCTCTAGGTGG - Intronic
1163793868 19:19324353-19324375 GTCTCTCCAGGGTCATGATGAGG + Intronic
1164514573 19:28922851-28922873 CTCTCTGCAGAGTCCTGAGGTGG - Intergenic
1164754753 19:30681300-30681322 GCCTGTGCAAGGTGCTGAGGAGG + Intronic
1164777901 19:30868513-30868535 GGCTCTGCTGAGTCCTCAGGAGG - Intergenic
1164876780 19:31696439-31696461 CTCTCTGCAGAGTCTTGAGGTGG + Intergenic
1165047138 19:33114120-33114142 CACTGTGTAGGGTCCTGGGGAGG - Intronic
1165572972 19:36791188-36791210 GACCCTGAAGGGACCTGAGCGGG - Intergenic
1165621336 19:37251336-37251358 GACCCTGCAGGGGCCTGAAAGGG - Intergenic
1165912126 19:39236086-39236108 GACTCTGCAGGGCCCTAAGGTGG - Intergenic
1166701141 19:44882335-44882357 GACGCTGCAGGGGGCAGAGGAGG + Exonic
1167259699 19:48451361-48451383 GCCTCTTCAGGGTACAGAGGAGG + Intronic
1168187542 19:54709580-54709602 GACCCTGCAGGGCCCTGTCGTGG + Intergenic
925249623 2:2421465-2421487 TACTCTTCATGGGCCTGAGGTGG - Intergenic
925275588 2:2645726-2645748 GACCCTGCGGGGTCCAGAGAGGG - Intergenic
925978947 2:9161604-9161626 GACTCTGCAGGACCCTAGGGTGG - Intergenic
926353821 2:12021692-12021714 GACTGGGCAGGGTGCTGAGCTGG + Intergenic
926942127 2:18149642-18149664 CTCTCTGTAGAGTCCTGAGGTGG + Intronic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
927491912 2:23526436-23526458 GGCTCTGCAGGGGCCGGGGGAGG + Intronic
927812537 2:26187912-26187934 TGCTCTGCAGGGACCCGAGGCGG + Exonic
927904518 2:26847635-26847657 GCCTCGGCGGGGTCCTGCGGCGG + Intergenic
928790145 2:34940355-34940377 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
928950395 2:36808525-36808547 GAGGCTGCAGGGTCTTGTGGAGG - Exonic
929181358 2:39043663-39043685 GACTCTGCAGAGTCCTGACGCGG + Intronic
930256727 2:49101851-49101873 GACTCTGTAGAGTCCGAAGGTGG + Intronic
931198649 2:60076457-60076479 GAGTCTGCAAGGTACTGATGCGG - Intergenic
932637733 2:73407132-73407154 GACTCTGCAGAATCCTGAGGTGG + Intronic
932900793 2:75697513-75697535 CTCTGTGCAGGGTCCTGAGGTGG - Intronic
933968629 2:87451855-87451877 CTCTCTGCAGAGTCCTGAGATGG + Intergenic
934656737 2:96120317-96120339 GACTCTGCCTGGTACTTAGGGGG + Intergenic
934673057 2:96228903-96228925 GACTCTACCGAGTCCTGAGGTGG + Intergenic
935710364 2:105893155-105893177 GTCACTGCAGGGCCCTGACGAGG - Exonic
936325165 2:111498650-111498672 CTCTCTGCAGAGTCCTGAGATGG - Intergenic
936444542 2:112585536-112585558 GAATCTGAAGGATCCTGAGATGG - Intronic
937472188 2:122183645-122183667 GGCTCTGGTGGGTCCTGAAGAGG + Intergenic
937512545 2:122612123-122612145 TACTCTGCATGGGCCTGTGGTGG + Intergenic
937884307 2:126889581-126889603 GGCTCTGCAGGGTGCTGAGCAGG + Intergenic
938295086 2:130172883-130172905 CTCTCTGCAGGGTCCTGTGAAGG - Exonic
938461540 2:131500952-131500974 CTCTCTGCAGGGTCCTGTGAAGG + Intergenic
938571713 2:132567508-132567530 GACCCTGCAGAGTGCTGAGGAGG - Intronic
938679166 2:133671587-133671609 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
938909873 2:135876208-135876230 GACGCCGCAGGCTCCGGAGGCGG + Intronic
938918426 2:135968475-135968497 GACTCTGCAGAGCCCTAAGGTGG + Intronic
938985867 2:136575769-136575791 GACCCTGCAGAGTACTGAGGTGG + Intergenic
939354496 2:141083778-141083800 CTCGCTGCAGAGTCCTGAGGTGG - Intronic
940788331 2:158005744-158005766 GACACTGCAGGGACCAGTGGGGG + Intronic
940866320 2:158820883-158820905 TTCTCTGCAGAGTCCCGAGGTGG - Intronic
942060491 2:172224663-172224685 GACTCTGCAAGGTCCAAAAGAGG - Intergenic
942606839 2:177700935-177700957 GACTCTGCAAGGTCCTGCTCAGG + Intronic
942659966 2:178254003-178254025 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
942908718 2:181215276-181215298 GACTCTGCAAAGTCCTGAAATGG - Intergenic
943635687 2:190304353-190304375 GACTCTGCAGAGACCCAAGGAGG + Intronic
943859459 2:192842281-192842303 AACTCTGCTTGGTGCTGAGGGGG - Intergenic
944422387 2:199545191-199545213 GACTCTGCAGAGTACCAAGGAGG + Intergenic
944428871 2:199611979-199612001 TTCTCTGCAGAGTCCTGAGGTGG - Intergenic
945406919 2:209459887-209459909 GACTCTCCATGGGCCTGAGAGGG - Intronic
946146879 2:217737791-217737813 GACTCTGCAGATACCTGAGCTGG - Intronic
947105375 2:226663057-226663079 GACTCTGCAGGGAACCCAGGTGG + Intergenic
947605426 2:231482882-231482904 GACGCGGCAGGGGCCCGAGGTGG + Intronic
948575142 2:238945081-238945103 CTCTTTGCAGAGTCCTGAGGTGG + Intergenic
948808813 2:240464826-240464848 GACACTGCAGGGTCCTTGGGGGG - Intronic
1169249798 20:4051651-4051673 GACTCTGCAGAGTCTCCAGGTGG - Intergenic
1169395070 20:5221825-5221847 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1169496653 20:6122500-6122522 AGCTCTGCAGGATCCTGGGGCGG + Intronic
1169747766 20:8960500-8960522 GATTCTCCAGGGTCAAGAGGTGG - Intronic
1170004109 20:11646919-11646941 AACTCTGGAGGGGGCTGAGGTGG - Intergenic
1170060946 20:12258576-12258598 TTCTCTGCAGAGTCCTGAAGTGG + Intergenic
1170946120 20:20892352-20892374 CACACTGCTGGGGCCTGAGGGGG + Intergenic
1171445370 20:25199034-25199056 GGCTCAGCAGTGTACTGAGGGGG - Intronic
1171527860 20:25829992-25830014 GACCCTGAAGGGACCTGAGGGGG - Intronic
1171548966 20:26025888-26025910 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1172081570 20:32345214-32345236 GACTCTGAAGGCTTCTGAGCTGG + Intergenic
1172206855 20:33168514-33168536 AACAATGCAGGGTCATGAGGTGG + Intronic
1172223250 20:33287887-33287909 GACTCTGGAGGGGCATGGGGGGG - Intronic
1172583064 20:36063967-36063989 CCCTATGCTGGGTCCTGAGGTGG - Intergenic
1173844064 20:46177071-46177093 GCCTCTGCTGGGACCTGAGGAGG + Intronic
1173912657 20:46681773-46681795 GACTCTACAGAGACCTGAGGCGG + Intronic
1174066333 20:47868328-47868350 GCCTCTGCAGGCTTCTGAGATGG + Intergenic
1175296940 20:57915041-57915063 GGCTCTGCAGATTCCCGAGGTGG + Intergenic
1175531442 20:59676092-59676114 GGCCATGCAGAGTCCTGAGGCGG - Intronic
1175850786 20:62091267-62091289 GAACCTGCAAAGTCCTGAGGTGG + Intergenic
1177264841 21:18769164-18769186 GACTCTGCAGAGTCCCTTGGTGG - Intergenic
1178534305 21:33399678-33399700 TTCTCTGCAGAGTCATGAGGTGG - Intergenic
1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG + Intergenic
1179358964 21:40687848-40687870 ATCTCTGCAGGGGCCTGGGGAGG + Intronic
1179370235 21:40800123-40800145 GACTCTGTAAAGTCCTGAGGTGG - Intronic
1179641139 21:42747775-42747797 GAGTCTGCAGGAGCCTGGGGTGG + Intronic
1180005717 21:45019482-45019504 CTGGCTGCAGGGTCCTGAGGTGG + Intergenic
1180024162 21:45149146-45149168 GCCTCTGCTGGCTCCTGATGTGG + Intronic
1180064395 21:45405312-45405334 GGCTCGGCCGGGTCCTGCGGGGG + Intronic
1180112839 21:45672202-45672224 GACTCTGCAGAGTCCTGAGGTGG - Intronic
1180800921 22:18631489-18631511 GACCCTGTTGGGCCCTGAGGAGG - Intergenic
1181053980 22:20251072-20251094 GCCTCTGCAGGGTTCCAAGGTGG - Intronic
1181392635 22:22594776-22594798 GACACTGCAGGCACCTGAGTTGG - Intergenic
1182118096 22:27769203-27769225 GACTCTGAAGGTTCCCTAGGAGG - Intronic
1183523586 22:38310663-38310685 GCCCATGCAGGGTCCAGAGGTGG - Intronic
1183603269 22:38852379-38852401 GACTCTACAGAGTCCCGAGGTGG - Intergenic
1184391643 22:44206663-44206685 AACTTGACAGGGTCCTGAGGAGG + Exonic
1184393658 22:44219885-44219907 TCCTCTGCAGAGTCCCGAGGTGG + Intergenic
1184394110 22:44222545-44222567 CTCTCTGCAGAGTCCCGAGGTGG + Intergenic
1185142076 22:49108137-49108159 AACTGTGCAGGGCCCCGAGGTGG - Intergenic
949374953 3:3378982-3379004 GACTCTGCAGAGTGCTGAGGTGG + Intergenic
949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG + Intronic
949866231 3:8549788-8549810 CTCTCTGCAGAGTCCTGAGGTGG + Intronic
950126614 3:10513723-10513745 GAATGTGCAGGGGGCTGAGGGGG + Intronic
950134609 3:10571772-10571794 GACACTGCTGGGTGCTGAGTGGG - Intronic
951078945 3:18428203-18428225 TTCTCTGCAGAGTCCTGTGGTGG + Intronic
952327848 3:32336979-32337001 GACTCTGCAGAGTTTTGAGGCGG + Intronic
952413064 3:33066436-33066458 GACTCTGCAGAGTCCTGAGGGGG - Intronic
952933824 3:38379971-38379993 CTCTCTGCAGAGTCCTGAGGAGG + Intronic
953147925 3:40295773-40295795 CTCTCTGAAGGGTCCTGAGGTGG - Intergenic
953833675 3:46324968-46324990 TACTCTGAAGAGTCTTGAGGTGG + Intergenic
954105624 3:48408401-48408423 GACTCTGCAGGTCCATGAGTGGG - Intronic
954405766 3:50344234-50344256 CACTGTGAAGGGTCCTGAGTAGG - Intronic
955792850 3:62606464-62606486 CTCTCTGCAGAGTCCTAAGGTGG - Intronic
956708302 3:72018447-72018469 GAAACTGCAGGATCCTGTGGAGG - Intergenic
956741990 3:72282353-72282375 GACTCTGTAGAGTCCTGGGATGG - Intergenic
956743644 3:72294278-72294300 GATTCTACAGAGTCCTGAGGTGG - Intergenic
957997656 3:87710732-87710754 GACTCTGTAGAGTCCTGAAGGGG - Intergenic
958479000 3:94622599-94622621 GAGGCTGCAGTGTGCTGAGGTGG + Intergenic
958927588 3:100175928-100175950 GAGTCTGCAGGGCTCTCAGGAGG - Intronic
960602201 3:119469281-119469303 TACTCTCCAGGGTCCAGAGCAGG - Intronic
960766293 3:121134180-121134202 GACTCTGTGGTGTCCCGAGGTGG + Intronic
961313570 3:126019133-126019155 GACTCTGCAGAGTCCGGAGGTGG + Intronic
961742116 3:129039541-129039563 CCCTCTCCAGGGTCCTCAGGGGG + Intronic
962390503 3:134967602-134967624 GACTCTGCAGAGCCCTGAAGTGG - Intronic
962505136 3:136039107-136039129 TACTCTTCAGGCTCCTGTGGGGG + Intronic
963344283 3:144075287-144075309 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
964626748 3:158767103-158767125 GAAATTGCAGGGTCCTGTGGGGG - Intronic
965652618 3:170948985-170949007 GACTCTACAGAGTCCCAAGGTGG + Intergenic
966885161 3:184373429-184373451 GGCTCTGCAGGGCCCCAAGGAGG + Exonic
966897575 3:184457301-184457323 CTCTTTGCAGAGTCCTGAGGTGG + Intronic
967762877 3:193244713-193244735 GACTCTGCAGAGTCCCAAGGTGG + Intronic
967989509 3:195120755-195120777 GACTCTGCGGGGTCCCGGAGGGG + Intronic
968468247 4:764022-764044 GAGGCTGCAGGGGCTTGAGGAGG + Intronic
968592983 4:1468850-1468872 GAGAATGCAGGGTCCAGAGGAGG + Intergenic
968726087 4:2248442-2248464 AGCACTGCAGGGCCCTGAGGTGG - Exonic
968813590 4:2810761-2810783 GGGGCTGCAGGGTCCAGAGGAGG - Intronic
968905704 4:3449683-3449705 GACTCTGCTGGGGCCTGGAGAGG - Intergenic
969058347 4:4415759-4415781 GACTCTGCTGGGTGCCGAGGTGG + Intronic
969335932 4:6510249-6510271 GAATCTTCAGGGTCCTGAGCAGG - Intronic
969897276 4:10317182-10317204 CACTCAGCAGGACCCTGAGGAGG - Intergenic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
970811587 4:20100442-20100464 GACTCTGCAAAGTCCTAAAGTGG - Intergenic
971331934 4:25688831-25688853 GACTCTGTAGAGTCCCAAGGTGG - Intergenic
975641224 4:76502143-76502165 GACTCTGGAGAGTCCCGAGACGG - Intronic
976425773 4:84901425-84901447 CTCTCTACAGAGTCCTGAGGTGG - Intronic
978157347 4:105505171-105505193 GACTCTGCAGGGGTATGAGCAGG + Intergenic
979018902 4:115469089-115469111 GACTCCGCAGAGTCCAGAGGTGG - Intergenic
979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG + Intronic
981361021 4:143845743-143845765 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981371759 4:143966745-143966767 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981380849 4:144069943-144069965 GATTCTGTAGAGTCCTGAGGTGG + Intergenic
982383117 4:154770955-154770977 GACTCTGCAGGGTCCTGCATGGG - Intergenic
982436030 4:155383941-155383963 GGCTCCACAGGGTCCTGTGGGGG + Intergenic
983634528 4:169883595-169883617 CCCTCTGCAGAGTCCTGAGGGGG - Intergenic
983895118 4:173072964-173072986 GACTCTGAAGAGTCCCGAAGTGG - Intergenic
984564449 4:181310998-181311020 TACTCTGCATGCTGCTGAGGAGG + Intergenic
984927592 4:184820118-184820140 GAGTCTGCAGGGATCGGAGGGGG - Intronic
985025078 4:185732563-185732585 CACTCTGCAGGGGCCCCAGGAGG - Intronic
985839972 5:2298777-2298799 GACTCTGCAGGCTCTAGAAGAGG - Intergenic
985903368 5:2814254-2814276 GACTCTGCAGGGAAAGGAGGTGG + Intergenic
986048652 5:4065989-4066011 GCCTCTGCAGGCTCCTCAGATGG + Intergenic
986340118 5:6781670-6781692 CTCTCTGCAGAGTCCTGAGTTGG - Intergenic
986923832 5:12721181-12721203 CTCTCTGCAGAGTCCTAAGGTGG - Intergenic
986936586 5:12895781-12895803 GACTCTGGAGGATTCTGATGTGG - Intergenic
987798988 5:22668537-22668559 CTCTCTGCAGAGTTCTGAGGTGG + Intronic
988681224 5:33486029-33486051 GCCTCTGCAGGGAACAGAGGTGG - Intergenic
990463613 5:56052031-56052053 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
990477963 5:56180083-56180105 CTCTCTGCAGAGTCCTGAGGTGG + Intronic
991988231 5:72311637-72311659 GACTATTCAGAGTCCTGAGGTGG - Intronic
992158483 5:73977975-73977997 CTCTCTGCAGAGTCCCGAGGAGG - Intergenic
992214178 5:74509028-74509050 CTCTCTGCAGAGTCCTGAGGTGG - Intergenic
992478071 5:77123200-77123222 ATCTCTGCAGAGTCCCGAGGTGG + Intergenic
994406614 5:99352878-99352900 AAGTCTGGAGGGGCCTGAGGTGG + Intergenic
995345641 5:111113748-111113770 GACTCTGAAGAGTCCCAAGGTGG + Intronic
996102580 5:119459655-119459677 GACTCTGTAGAGTCCCGAGATGG + Intronic
997141029 5:131380882-131380904 CACGCTGCAGGGGACTGAGGTGG - Intronic
997189122 5:131914131-131914153 CTCTCTGCAGAGTCCCGAGGTGG - Intronic
997476676 5:134146458-134146480 TGCTCTGCAGGGTGCTGCGGGGG - Exonic
997758228 5:136420473-136420495 GAAGCTGCAGGCCCCTGAGGAGG + Intergenic
999589428 5:153128542-153128564 TACTCAGAAGGGTCCTGGGGAGG + Intergenic
999617777 5:153443326-153443348 GACTCTGCAGAGTCCTGAGGAGG + Intergenic
1000013156 5:157252764-157252786 GCCTCTGGAGGGTCCTGGGCTGG - Exonic
1000268748 5:159662903-159662925 GACTCTGCAGAGTTCTGAGATGG + Intergenic
1001121272 5:168982375-168982397 CTCTCTGAAGGGTCCTTAGGTGG - Intronic
1001163023 5:169338182-169338204 GACTCTGCAGAGTCCCAAGGTGG + Intergenic
1001692164 5:173641333-173641355 AACTCACCAGGGTCCTGAGAAGG - Intergenic
1001931552 5:175676726-175676748 GACTCTGAAGGGTGAGGAGGTGG - Intronic
1002162603 5:177324578-177324600 GACTCTGCAGAGTCTGGAGCTGG + Intergenic
1002986155 6:2191668-2191690 GAGTCTGGAGGGAGCTGAGGTGG - Intronic
1003232715 6:4269209-4269231 GACTCTGCAGAGCCCTGAGGTGG - Intergenic
1003613795 6:7636913-7636935 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1003616419 6:7659038-7659060 TTCTCTGCAGTGTCCTGAGGTGG + Intergenic
1003863546 6:10343495-10343517 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1004173525 6:13318114-13318136 CTCTCTGCAGGGTCCTGAGGTGG - Intronic
1004246052 6:13977132-13977154 GACTCCGCAGTGTCTTCAGGAGG - Exonic
1005006469 6:21292275-21292297 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1005442092 6:25881185-25881207 GACTCTGCAGAGTCCAGATCTGG - Intronic
1005912081 6:30319310-30319332 AACTCTGCAGAATCCTGAGGTGG - Intergenic
1006122401 6:31815347-31815369 GACTCTGGAGAGTTCTGAGCAGG + Intergenic
1006309822 6:33249695-33249717 CACTCTCCAGGGACCTGGGGAGG + Intergenic
1006423618 6:33950408-33950430 GCCTCTACAGGGTGCTGTGGGGG - Intergenic
1006843921 6:37049920-37049942 CACTCAGCAGGGTCCTGAGGAGG + Intergenic
1007526874 6:42503724-42503746 GACTCTGCAGAGCCCCAAGGTGG + Intergenic
1010926813 6:81753840-81753862 GACGCTGCCGGGGGCTGAGGTGG + Intergenic
1014227415 6:118863753-118863775 CTCTCTGCAGAGTTCTGAGGTGG - Intronic
1015759940 6:136647887-136647909 GACTGTGCTGGTTCCTGAGGAGG - Intronic
1016386024 6:143531667-143531689 CTCCCTGCAGGGTCCGGAGGTGG - Intergenic
1016440312 6:144076531-144076553 CTCTCTGCAGAGTCCTGAGGTGG - Intergenic
1017232520 6:152088663-152088685 GACTCTGCGGGGTCCCGAGATGG - Intronic
1017484226 6:154888344-154888366 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1019144681 6:169969128-169969150 GTCTCTGGAGGAGCCTGAGGTGG + Intergenic
1019361987 7:609404-609426 GAGGCAGCAGGGTCCTGAGCTGG - Intronic
1020199924 7:6071766-6071788 GACTCTGCAAAGTCCCGAGGTGG + Intergenic
1020457878 7:8394822-8394844 GAATCTGCAGGTCCTTGAGGAGG - Intergenic
1022468439 7:30666650-30666672 GACTATGCTGGGTAATGAGGAGG + Intronic
1023320668 7:38994370-38994392 GATTCTGCAGGTCCCAGAGGAGG + Intronic
1023729419 7:43176522-43176544 GACTCTGCAGAGGCCTGAGGTGG + Intronic
1023893196 7:44409018-44409040 AACTTTGCAGCCTCCTGAGGTGG + Intronic
1024116702 7:46201090-46201112 GACTCTGCAGAGTCCCAAGGTGG + Intergenic
1025937786 7:66050985-66051007 GAGGCTCCATGGTCCTGAGGGGG + Intergenic
1026367805 7:69667085-69667107 GACTCTACAAAGTCCTGAGGTGG + Intronic
1026615476 7:71899120-71899142 GTCTCTGCAGGGGCCTGGGAGGG - Intronic
1027331617 7:77101578-77101600 GGCTCTGCAGAGTCATGAAGTGG - Intergenic
1027496638 7:78895232-78895254 CTATCTGCAGAGTCCTGAGGTGG - Intronic
1027878271 7:83799809-83799831 GTCTTTGCAGGGTTTTGAGGGGG + Intergenic
1028445939 7:90924178-90924200 CTCTCTGCAGAGTCCTGAGGCGG + Intronic
1028534094 7:91872028-91872050 GACTCTGAAGAGTCCTGAGGCGG - Intronic
1029222397 7:99000765-99000787 GACCCTTCAGGGTGCTGATGAGG - Intronic
1029784155 7:102769762-102769784 GGCTCTGCAGAGTCATGAAGTGG + Intronic
1030028921 7:105351226-105351248 GACTCTGCAGAGTCCCAAGGTGG - Intronic
1031226125 7:119040468-119040490 GACTCTGCAGAGTCCAGAGGTGG - Intergenic
1032850984 7:135795193-135795215 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1032892638 7:136215784-136215806 TACTCTGCAGAGTCCTGAGGTGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033561543 7:142536714-142536736 GACTCTGCAGAGTCCCCAGGTGG + Intergenic
1035106699 7:156446984-156447006 GTCTCTGCAGAATCCAGAGGTGG + Intergenic
1035197218 7:157231690-157231712 GACTCTGCAGAGTCCGGAGGCGG - Intronic
1035360266 7:158307963-158307985 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG + Intronic
1037790508 8:21935783-21935805 GACTCTGCATGGGCATGAGAAGG - Intronic
1038027635 8:23606445-23606467 AACACTGCAGGGTTCTGGGGAGG - Intergenic
1038157067 8:25000759-25000781 GACTCAGCAGCCTCCTGCGGCGG - Intergenic
1038158829 8:25017226-25017248 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1038323600 8:26552626-26552648 TTCTCTGCAGAGTTCTGAGGAGG + Intronic
1039000543 8:32974783-32974805 GGCTCTGCAGGGCCCTTAGAGGG + Intergenic
1039449804 8:37663315-37663337 TTCTCTGCAGGGTCCTGAGGAGG + Intergenic
1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG + Intronic
1040788311 8:51193825-51193847 GACTCAGAGGTGTCCTGAGGAGG + Intergenic
1040963800 8:53064142-53064164 GGATCTGCAGGGACCAGAGGTGG - Intergenic
1041153969 8:54964487-54964509 GACTCTGCAGAGTCCTCAGGTGG - Intergenic
1041356682 8:57007886-57007908 CACTCTGCAGAGTCTTGAGGGGG - Intergenic
1041358830 8:57029057-57029079 CTCTCTGCAGTATCCTGAGGCGG - Intergenic
1041505262 8:58590303-58590325 GACTCTCCAGGGTCCTGCCCTGG + Intronic
1041732942 8:61081130-61081152 GACACTGAAGGTTTCTGAGGAGG + Intronic
1042867474 8:73368471-73368493 GACTCTGCAGTGTCCCCAGGTGG + Intergenic
1044163876 8:88955795-88955817 GACTCTGCAGAGTCCCAAGGTGG - Intergenic
1045505168 8:102773147-102773169 GACTCTGCAGGTTCCCAAAGTGG + Intergenic
1045518132 8:102879144-102879166 GACTCTGCAGTGTCCTGAGGTGG - Intronic
1046880598 8:119302977-119302999 GACTCTGAAGAGTCCTGAAGTGG + Intergenic
1047440369 8:124872282-124872304 CACTCTGCAGGATCATGAGAGGG - Intergenic
1047862447 8:128983294-128983316 GACCCTGCCGAGTCCTGGGGAGG - Intergenic
1048053062 8:130837474-130837496 GTCTATGCAGGGTGCTGTGGAGG - Intronic
1048321503 8:133403981-133404003 GTCTCTGCAGGATCCAGAGTGGG - Intergenic
1048835608 8:138516061-138516083 GTCTCTGAGGGGTCCTCAGGAGG + Intergenic
1049010348 8:139883224-139883246 GACTCTGCAGAGTGCTCAGGTGG - Intronic
1049229853 8:141476291-141476313 GCCTCTGCAGGGCCTTGAGCTGG + Intergenic
1049303408 8:141883802-141883824 GGCTTGGGAGGGTCCTGAGGTGG - Intergenic
1049439532 8:142602818-142602840 GATTCTGGAGGGACCAGAGGGGG + Intergenic
1049631335 8:143659773-143659795 GACTCTGCAAAGTCCAGAGATGG + Intergenic
1049684133 8:143932525-143932547 AGCTCTCCAGGGACCTGAGGCGG + Exonic
1049781765 8:144432383-144432405 GGCTCTGCAGGGTCCTGGCCAGG + Exonic
1049917995 9:336978-337000 CTCTCTGTAGAGTCCTGAGGTGG + Intronic
1052219936 9:26007877-26007899 GACTCTGCAGAGTCCCAAGGTGG - Intergenic
1052597065 9:30574793-30574815 GAGTCTGGAGGGGGCTGAGGCGG - Intergenic
1052834227 9:33238481-33238503 GACTGTGCAGTTTCCTAAGGAGG + Intronic
1053010037 9:34627885-34627907 GACCCTACAGGCCCCTGAGGGGG - Exonic
1053240458 9:36490316-36490338 GACTCTGCACAGTCCTGAGGTGG - Intergenic
1054149356 9:61588734-61588756 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1054469116 9:65519845-65519867 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1054765576 9:69039881-69039903 GACTTTGCAGAGTATTGAGGCGG + Intronic
1054804664 9:69386027-69386049 TAAACTGCAGGGTCCTGAGCTGG - Intronic
1055020627 9:71665593-71665615 GACTCTGAAGAGTCGTGTGGCGG - Intergenic
1055140444 9:72871220-72871242 GACTCTGCAGAGTCCCATGGTGG + Intergenic
1055843898 9:80537699-80537721 GACTCTGCAGGGTTCTGAGGTGG - Intergenic
1056103489 9:83323572-83323594 CTCTCTGCAGAGTCCTGAAGTGG - Intronic
1056454726 9:86748781-86748803 CTCCCTGCAGAGTCCTGAGGTGG - Intergenic
1056566901 9:87781201-87781223 ATCTCAGCAGAGTCCTGAGGTGG + Intergenic
1056783803 9:89573482-89573504 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1056990573 9:91406490-91406512 AACTCTGCAGGAGGCTGAGGAGG - Intergenic
1057304889 9:93906330-93906352 GAAGCTGCAGGGCCGTGAGGAGG + Intergenic
1057553000 9:96065781-96065803 GACTCTGCAGGGCCCCAGGGTGG - Intergenic
1058395406 9:104547567-104547589 GACACTGCAGAGTCCCAAGGTGG + Intergenic
1058562973 9:106249359-106249381 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1058639946 9:107073902-107073924 GACTCTGAAGGTTTCTGAGCAGG - Intergenic
1058789570 9:108429114-108429136 AATTCTGCAGCGGCCTGAGGTGG + Intergenic
1059289938 9:113213698-113213720 CTCTCTGCAGGGTCCTGAGATGG - Intronic
1059341704 9:113601089-113601111 GAATCTGGTGGGTCCAGAGGTGG - Intergenic
1060807831 9:126588573-126588595 GACAAGGCAGGGTTCTGAGGAGG + Intergenic
1061770952 9:132920893-132920915 GCCTCTGTAGGGCCCTGGGGAGG + Intronic
1062618630 9:137409249-137409271 GACTCCGAAGGGTCCTGAGGCGG - Intronic
1185928314 X:4171911-4171933 GACCCAGCAGGGGCCTGAGATGG + Intergenic
1185963785 X:4576902-4576924 GACTTTGCAGAATCCCGAGGTGG - Intergenic
1186374750 X:8987618-8987640 GTCTCTGCAGGGAGGTGAGGGGG + Intergenic
1186387824 X:9127756-9127778 GACTCTGCAGAGTCCTGAATTGG - Intronic
1186790218 X:12990220-12990242 CTCTCTGCAGAGTCCTGAGGCGG - Intergenic
1186792918 X:13016332-13016354 GACACTGCAGGGACTTGTGGTGG + Intergenic
1186809564 X:13174909-13174931 GACTCTGCAGAGTTCTGAGGTGG + Intergenic
1186987915 X:15036629-15036651 GACTCTGCAAAGTTCTGAGGTGG + Intergenic
1187813857 X:23209733-23209755 GATTCTGGAGAGTCCTGTGGAGG - Intergenic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1190234676 X:48606320-48606342 GACTCTGCTGCCTCCTCAGGGGG + Exonic
1190276382 X:48902179-48902201 GAGGCTGCTGGGTCCTGGGGTGG + Intronic
1190583699 X:51915546-51915568 GACACTGCAGAGTCCCGAGGCGG - Intergenic
1192229580 X:69255904-69255926 GGCTCTGAAGAGCCCTGAGGGGG - Intergenic
1192473201 X:71417259-71417281 AACTCTGCAGAGTCCCGAGGTGG - Intronic
1192620300 X:72672431-72672453 AACTCTGCAGAGTCCCAAGGTGG + Intronic
1195667728 X:107445740-107445762 GACTCTGCAGGTTGCTAAGCTGG - Intergenic
1195849107 X:109264088-109264110 TACTCTCCATGGGCCTGAGGTGG - Intergenic
1196317891 X:114250745-114250767 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1199762679 X:150917195-150917217 GATTCTGCAGAGTACTGAGGTGG - Intergenic