ID: 1190144983

View in Genome Browser
Species Human (GRCh38)
Location X:47882347-47882369
Sequence TTTGATTCCATTACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190144983_1190144985 4 Left 1190144983 X:47882347-47882369 CCTGTCTTTGTAATGGAATCAAA 0: 1
1: 1
2: 1
3: 14
4: 192
Right 1190144985 X:47882374-47882396 CTGTGTCTGACTTCAGTGTTTGG 0: 1
1: 1
2: 1
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190144983 Original CRISPR TTTGATTCCATTACAAAGAC AGG (reversed) Intronic
903900359 1:26640316-26640338 TTTTATTACAGTACATAGACTGG + Intergenic
909716634 1:78715831-78715853 TTTGCTTACATCACAAAAACTGG + Intergenic
910514400 1:88043055-88043077 TTGGACTCCATTACAAAAATTGG + Intergenic
911210957 1:95137510-95137532 TGTGATTCCTTTGCAAATACAGG - Intronic
911694632 1:100875900-100875922 TTTCATTTCATTCCAAGGACTGG + Intronic
912221509 1:107682494-107682516 TTTGAAGCCATTAAAAAAACAGG - Intronic
912989241 1:114467650-114467672 TTTGTTTCAGTTACACAGACAGG - Intronic
913708191 1:121449441-121449463 TTTGATTACATTACAATTAAAGG + Intergenic
915799474 1:158774084-158774106 TGTGATACCATAAAAAAGACAGG - Intergenic
916998385 1:170327139-170327161 TTTCTTTCCTTTACAAAGTCTGG - Intergenic
917544425 1:175948715-175948737 TCTGATTCCATTAAAAATTCTGG - Intronic
918905099 1:190481729-190481751 TTACATTCTATTACTAAGACAGG + Intergenic
918921723 1:190720585-190720607 TTTGTTTCCATTAGAAAAACTGG + Intergenic
919010711 1:191958585-191958607 TTGGATTTTATTCCAAAGACAGG + Intergenic
919536921 1:198798518-198798540 ATTGATGCCATTACAAAAAGTGG + Intergenic
920236851 1:204513218-204513240 ATTGATTCGAATAAAAAGACAGG - Intergenic
922038923 1:221876568-221876590 ATTGATTCCCTCACAAAGAAGGG - Intergenic
923654395 1:235903036-235903058 TTTGATTTCATTTCAAGGCCTGG - Intergenic
923715017 1:236417782-236417804 TTTTCTTCCATTACAAATAGTGG - Intronic
1063207870 10:3851792-3851814 TTTGCTGACATTACAAAGAAAGG + Intergenic
1064161495 10:12950407-12950429 TTTGTTTCAATTAAAAATACAGG + Intronic
1064422708 10:15204282-15204304 TTTGTTTCCATTAGAAAGTTAGG - Intergenic
1065350358 10:24790139-24790161 TTTGATTCTATTACTAGTACAGG + Intergenic
1066293942 10:34037966-34037988 ATAGATTCCATGACAATGACAGG + Intergenic
1066675023 10:37878665-37878687 TTTGGTACCATTACAAATAGTGG - Intergenic
1066826562 10:39598110-39598132 GATGTTTCCATTACAAAGATTGG - Intergenic
1068751827 10:60602699-60602721 TTTCCTTCCATTATAAATACGGG + Intronic
1069078200 10:64060643-64060665 TTTGCTTACATTAAAAAGATCGG + Intergenic
1071149904 10:82621704-82621726 TTTGATTCCGTCACAAAAGCAGG - Intronic
1073683191 10:105727242-105727264 GTTGATTCCATTTCAAAGGGTGG + Intergenic
1078437536 11:11337897-11337919 TTTGATGCCATGCCAAACACTGG + Intronic
1079748317 11:24161196-24161218 TTTAATTTCATTACAAATTCTGG - Intergenic
1083671424 11:64301974-64301996 GATGATTCCATTAAAAACACAGG - Intronic
1084513730 11:69623482-69623504 TTTGTTTCCTTTACACAGATGGG - Intergenic
1086211713 11:84328528-84328550 TATGATTGCATTACAAATTCTGG - Intronic
1087548967 11:99622373-99622395 GTTGTTTCCATTACAAATTCAGG - Intronic
1087582194 11:100071689-100071711 TTTAATTCCATTACAGAGTAGGG + Exonic
1087954725 11:104271500-104271522 TTTGTTTACATTACAGAGAGCGG - Intergenic
1088169914 11:106984271-106984293 TTTGACTCCAGTATAAAGAGGGG - Intronic
1089794018 11:120966060-120966082 TTAGATTTCATTACAAAAACAGG - Intronic
1091517109 12:1195886-1195908 ATTGCTTCCATTACAAAAAAAGG - Intronic
1093304297 12:17494243-17494265 TTTTATTGCACTACATAGACAGG - Intergenic
1094619924 12:32070345-32070367 ATTGACTTGATTACAAAGACAGG + Intergenic
1095809832 12:46360843-46360865 TTTTATTCCATTCCAGAGAATGG - Exonic
1099364885 12:81756572-81756594 TTTGATTCCACTCCTAAGGCAGG + Intronic
1099396053 12:82140923-82140945 ATTGCATCCATTTCAAAGACAGG + Intergenic
1099834062 12:87884962-87884984 TTTGATTTCTTTTCAAAGATAGG + Intergenic
1100654560 12:96627564-96627586 TTTGCTGCCATTTCAAAAACAGG - Intronic
1101322445 12:103684550-103684572 TTTCATTCCATTGCAAAGCTTGG + Intronic
1102725882 12:115064208-115064230 TTTGATTGAAATACAAAGAAGGG + Intergenic
1104677200 12:130719460-130719482 TTTGATTCCATCACCGAAACTGG - Intergenic
1107438875 13:40406193-40406215 TTTCATTCTATTTCAGAGACTGG - Intergenic
1108594644 13:51938772-51938794 TTTTTTTCCATTGCAAAGACTGG + Intronic
1108630790 13:52279846-52279868 TTGGATTCCGATAGAAAGACTGG + Intergenic
1108655900 13:52532694-52532716 TTGGATTCCGATAGAAAGACTGG - Intergenic
1109203059 13:59452422-59452444 TTTAATTTTATTCCAAAGACAGG + Intergenic
1109341083 13:61059890-61059912 TTGGATTTCATTCCAAAGTCAGG - Intergenic
1110509917 13:76337377-76337399 GATGATTACATTTCAAAGACAGG + Intergenic
1110554018 13:76838091-76838113 TGTGATTCCTTTACAATGGCAGG - Intergenic
1111030143 13:82586418-82586440 TTTGTTTCCATAAGAAAGAATGG - Intergenic
1111402718 13:87761945-87761967 TTTTATTCCATGATCAAGACAGG - Intergenic
1112354504 13:98662540-98662562 GATGATTCCATTGCAAAGAGGGG + Intergenic
1113438493 13:110310930-110310952 TCTCATTCAGTTACAAAGACAGG - Intronic
1114931802 14:27479532-27479554 TTTGATAGCATTAAAAAAACTGG + Intergenic
1116778216 14:49205814-49205836 TGTGACTCCATCTCAAAGACCGG - Intergenic
1118831238 14:69435118-69435140 TCTGCTTCTATTACTAAGACAGG + Intronic
1119847621 14:77842083-77842105 TTTGATTGTTTTACAGAGACAGG - Intronic
1120460193 14:84785218-84785240 TATGATTACATTAATAAGACAGG + Intergenic
1120650935 14:87131809-87131831 ATTGCTGCCTTTACAAAGACTGG + Intergenic
1120868941 14:89319974-89319996 TTGCATTTCATTACTAAGACAGG + Intronic
1121374919 14:93399710-93399732 TTTGGTTCCATGACAAGGAAAGG - Intronic
1121376921 14:93419890-93419912 TTTTATTCTTTTATAAAGACAGG - Intronic
1124569262 15:30846143-30846165 TTTCATTTCATTTCACAGACAGG - Intergenic
1126368946 15:47925581-47925603 TTTGATTCAAATACAAAGATAGG - Intergenic
1129754040 15:78085221-78085243 TTTTTTCCCATTATAAAGACAGG - Intronic
1137855837 16:51793901-51793923 TTTGATGCCATAAGAAAGATTGG - Intergenic
1140665838 16:77226405-77226427 TTTTATTCCATCACAAAAAGTGG - Intergenic
1140960273 16:79905152-79905174 TTTAATACCATTTGAAAGACAGG - Intergenic
1142019214 16:87770291-87770313 TTTGAATCCATTCCAGAGAGAGG + Intergenic
1142589944 17:999248-999270 TTTGATTACATTCCAAATGCTGG + Intronic
1144341600 17:14314668-14314690 TTTGTTGCCATAAGAAAGACAGG - Intronic
1148614799 17:48993645-48993667 TTTGACTCCATTTTAAAGATAGG - Intergenic
1149828703 17:59852270-59852292 TCTGATTCCATCAGAAAGCCGGG - Intergenic
1151485479 17:74396556-74396578 TTTTATTCCATTACCGAGCCAGG - Intergenic
1153400225 18:4677085-4677107 TTTGACTCAAGTCCAAAGACAGG + Intergenic
1155076535 18:22361768-22361790 TATAGTTCCTTTACAAAGACCGG - Intergenic
1155283680 18:24266991-24267013 TTTGATTACTTTTCAAAGAACGG - Intronic
1157394777 18:47332363-47332385 TTTTATTCTGTTACAAAGAGTGG - Intergenic
1157803826 18:50643491-50643513 TTTCATTCCATTACACAAGCTGG - Intronic
1158882611 18:61795532-61795554 TTTCATTCCATTTCAGGGACTGG + Intergenic
1160656906 19:277544-277566 TTTAATGGCATTACAAGGACAGG - Intergenic
1161228249 19:3158051-3158073 TTTTATTCCATTCCACAGAAGGG - Intronic
1162079042 19:8208238-8208260 TTTGATTTCCTCACACAGACAGG - Intronic
1162188880 19:8929072-8929094 TTTTATTCCATTCCACAGAGGGG + Intronic
1162394398 19:10408334-10408356 TTTCATTTCATTTTAAAGACGGG + Intronic
1164385538 19:27768176-27768198 TTCTCTTCCATTAGAAAGACTGG + Intergenic
1167820546 19:51923611-51923633 TTTTATTTTATTACATAGACTGG - Intronic
925182926 2:1828472-1828494 TTTTATTCCATAACAGAGAGAGG - Intronic
925825562 2:7845464-7845486 TTTGAATTCATTTCAAAGTCAGG - Intergenic
926677025 2:15633668-15633690 TTTGAGTCCCTTACTAGGACAGG + Intergenic
927225204 2:20757853-20757875 TTTAATTCCAGTCCAAAGGCTGG - Intronic
928764230 2:34622977-34622999 TTTGACTCCATCACAAAGTAAGG + Intergenic
931385676 2:61795607-61795629 TTGGACTCCATAACAATGACAGG - Intergenic
939120682 2:138112675-138112697 TTTCATTCCAAAACAAAGACTGG - Intergenic
941055784 2:160786304-160786326 TTTGATTCCATTAGAAAAATAGG + Intergenic
942695477 2:178637988-178638010 TTTGATTCCATTATTAATACAGG + Intronic
944199177 2:197087247-197087269 TTTGCATAAATTACAAAGACAGG - Intronic
944381499 2:199115947-199115969 TTTGATTCATATACAAATACAGG + Intergenic
944879202 2:203994314-203994336 TATGATTCAATTACAAGGAGTGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1177395293 21:20527250-20527272 TTTGCTTCCATTACAAATAATGG + Intergenic
1177583152 21:23053919-23053941 TATGATTCTATAACAAAGAAAGG - Intergenic
1180062789 21:45394094-45394116 TCTGATCCCATTTCAGAGACCGG - Intergenic
1181940651 22:26473317-26473339 CTGGATTCCATTACAAACAATGG + Intronic
1182406051 22:30131644-30131666 TTTGATTTAGTTACAAAGAATGG + Intronic
1182707233 22:32291624-32291646 TTTGATTTCTTTACCAAGATAGG + Intergenic
949373602 3:3362844-3362866 TTTTATTCCATTTCATAGACTGG + Intergenic
949402821 3:3683516-3683538 TTTCATGCTATTCCAAAGACTGG - Intergenic
951059325 3:18186569-18186591 TTTGAGTCCATTTGAAAGATAGG + Intronic
952081612 3:29765329-29765351 TTTGATTCCATATTTAAGACAGG + Intronic
953344133 3:42160769-42160791 TTTGATTCCATTACAAAGATCGG - Intronic
955684596 3:61537432-61537454 TTAGCTTCCATTACAAACTCAGG - Intergenic
956111520 3:65874587-65874609 TTTGATTGGTGTACAAAGACAGG + Intronic
957006221 3:74950420-74950442 GTTGATTTTATTACAAATACAGG - Intergenic
958271866 3:91509713-91509735 TTTGATTTCATTTGAGAGACAGG - Intergenic
958914893 3:100038621-100038643 TATGCTTCCATAACAAAAACTGG + Intronic
963262133 3:143203508-143203530 GCTGATTCCATTATACAGACAGG + Intergenic
963471766 3:145750181-145750203 TTTGATTCCATTGTTAAGATGGG + Intergenic
964159405 3:153628747-153628769 TTTGCTTCCTTTAAAAACACAGG + Intergenic
964899592 3:161642370-161642392 TTTAATTCGATTAAAAAAACAGG - Intergenic
965762698 3:172096346-172096368 TTTAAATCCATTATGAAGACTGG - Intronic
966033637 3:175382019-175382041 TAAGATTCTATTTCAAAGACAGG - Intronic
967345278 3:188448275-188448297 ATTATCTCCATTACAAAGACGGG - Intronic
967391247 3:188957092-188957114 TTTAATTCCAAAACAAAGTCTGG - Intronic
967422774 3:189292478-189292500 TATTATTCCATTTCATAGACAGG - Intronic
970416906 4:15867123-15867145 TATGATCCCATTTCAAAAACTGG + Intergenic
970938173 4:21599288-21599310 ATTGATTCCCTTTCTAAGACAGG - Intronic
973692937 4:53457927-53457949 TTGGATTGAATTACACAGACTGG - Intronic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
975571890 4:75826330-75826352 TTGGATTTCATAACAAAGACAGG - Intergenic
979124791 4:116955885-116955907 TTAGATTCCGTTACATAGTCAGG + Intergenic
980801581 4:137757912-137757934 TATGATTCCATTACAGAAAAAGG - Intergenic
981071125 4:140539996-140540018 TTTATTCCCATTAAAAAGACTGG - Intronic
984226066 4:177036257-177036279 ATGGATTCCATTTCAAGGACAGG + Intergenic
986825863 5:11521846-11521868 TTGCATTCTATTACAATGACAGG + Intronic
987138751 5:14923649-14923671 TTTTGTTACATTACAAAGATGGG + Intergenic
987398135 5:17445188-17445210 TTTGATACCATTAGAGAGATGGG + Intergenic
987941387 5:24543272-24543294 TTTGGTTTCATTCCAAAAACTGG + Intronic
989686263 5:44091013-44091035 TTTGGTTTCATTCCAACGACTGG - Intergenic
989969912 5:50511247-50511269 TTTGATTACATTACAATTAAAGG - Intergenic
990432351 5:55748387-55748409 TTTCATTCCTTTACAAATATTGG - Intronic
990733416 5:58833950-58833972 TTCGATTTCATTAAAAAGAAAGG - Intronic
992472128 5:77068448-77068470 TTTGATTGCATAACAAAGAAGGG + Intergenic
993481543 5:88430626-88430648 TTTGACTCCATGACAAATTCAGG + Intergenic
993502245 5:88677205-88677227 TTTGCTTTCATTTCAAAGTCAGG - Intergenic
994777577 5:104053914-104053936 TTTAATTCAATTAAATAGACTGG + Intergenic
994859413 5:105168813-105168835 TTTAAATCCAGTCCAAAGACTGG - Intergenic
995961627 5:117847052-117847074 TTTTATTCCCTTAGAAAGCCTGG - Intergenic
996689648 5:126326327-126326349 TGTGTTTTCTTTACAAAGACGGG - Intergenic
997651613 5:135525854-135525876 ATTGATTAAATTACAAAGATGGG - Intergenic
999593025 5:153169997-153170019 TTTGATTCTATAATGAAGACTGG - Intergenic
1000309771 5:160031088-160031110 GATGATCCCAGTACAAAGACTGG - Intronic
1000769211 5:165330789-165330811 TGTTATTCCTTTACCAAGACAGG - Intergenic
1000824583 5:166029338-166029360 TTTGATGGCATTAGAAAGAACGG - Intergenic
1000836495 5:166161173-166161195 TTTAATCCCATTTCAAAGACAGG - Intergenic
1001735842 5:173999815-173999837 TTTTATTGTATTAAAAAGACTGG + Intronic
1002491375 5:179580177-179580199 TTTGATTTGTTTACAAAAACGGG - Intronic
1003147948 6:3524760-3524782 TTTGATTCCATTGCACAGTTAGG + Intergenic
1004131934 6:12928796-12928818 TTTGAGTCTATAACAAAGACAGG + Intronic
1005324823 6:24689553-24689575 TTTTATTCAATTACAAAAATGGG - Intronic
1008852042 6:56034128-56034150 TTTGATTCCATTATAAAGATTGG - Intergenic
1009640153 6:66324938-66324960 TTTGATCCCATGACAAAGTAAGG + Intergenic
1011869208 6:91871480-91871502 TTTGTTGCCATTGCAAAAACTGG - Intergenic
1012678231 6:102144107-102144129 TGTGATTCCATTTAAAACACAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1015188949 6:130451987-130452009 TGTGATTCAATTACAATGAGAGG - Intergenic
1019508001 7:1403005-1403027 ATTGATTCCACCACAAACACTGG - Intergenic
1024546240 7:50522765-50522787 TATTGTTCCATTACAAAGAAAGG + Intronic
1024600093 7:50972847-50972869 TCTGATTCCATTCCACAGGCTGG + Intergenic
1028820216 7:95200701-95200723 TCTGATTACTTTACAAAAACAGG - Intronic
1034228174 7:149498243-149498265 ATTTATTCCATTTCAAACACAGG - Intergenic
1038934343 8:32231931-32231953 TTTTCTTCCATTACCCAGACTGG + Intronic
1040444612 8:47480944-47480966 TTTGCTTTCATAACAAAGAGTGG - Intronic
1041793150 8:61717568-61717590 TTTGATTTCCTTAAAAAGATAGG - Intergenic
1041963548 8:63648239-63648261 TTTGCTTCCATGACAAGGAAAGG - Intergenic
1042770787 8:72379669-72379691 TTTGATTTCCTTAGAAAGTCTGG - Intergenic
1043463629 8:80485721-80485743 TTTTGTTCCTTCACAAAGACTGG - Exonic
1043573990 8:81635974-81635996 TTTGATACCATTTAAAACACAGG - Intergenic
1043580765 8:81711049-81711071 TTTGTTACCATTTCAAACACAGG - Intronic
1044875849 8:96665757-96665779 CTTGTTTTCATTCCAAAGACAGG + Intronic
1047940054 8:129820938-129820960 GTTGTTTCCATTTGAAAGACAGG + Intergenic
1051511315 9:17881230-17881252 TTTGATTCAAAAACAAACACTGG - Intergenic
1051696755 9:19775986-19776008 TTTCATTCTATTAAAAATACTGG - Intronic
1051734093 9:20180397-20180419 TATGAGTTTATTACAAAGACGGG - Intergenic
1052343037 9:27381598-27381620 TTTAATTCCATCACAAAATCAGG - Intronic
1054927387 9:70602347-70602369 CTTGCCTTCATTACAAAGACAGG - Intronic
1055014885 9:71605772-71605794 TTTTATTACATTACAAAAAAGGG - Intergenic
1055433279 9:76266834-76266856 TTTGTGGCCATTAGAAAGACTGG + Intronic
1057411976 9:94824912-94824934 TTTGGTGCCATTAAAAACACAGG - Intronic
1058667194 9:107330770-107330792 TTTTATTGCATTGGAAAGACTGG + Exonic
1058923802 9:109642038-109642060 TTTGTTTCCATTGCAGAGATAGG - Intronic
1058932130 9:109731471-109731493 TTTGAATCCAGTAAAAAGAATGG + Intronic
1058936687 9:109776208-109776230 TTTGAACCCATTACAAACACAGG - Intronic
1060242195 9:121913746-121913768 TTTGATTTCAATACAAGCACTGG - Intronic
1186585336 X:10867351-10867373 TTTGACCCCACTTCAAAGACTGG + Intergenic
1190144983 X:47882347-47882369 TTTGATTCCATTACAAAGACAGG - Intronic
1191233282 X:58114443-58114465 TTCTTTTCCATTACAATGACTGG - Intergenic
1191725111 X:64271197-64271219 TTTGATGACATTAAAAAGCCTGG + Intronic
1197229498 X:123988654-123988676 ATTGCTTCCATAAAAAAGACTGG + Intronic