ID: 1190157337

View in Genome Browser
Species Human (GRCh38)
Location X:48004611-48004633
Sequence CAGTGTGTTGGGAGTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 2, 1: 0, 2: 4, 3: 29, 4: 400}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190157337 Original CRISPR CAGTGTGTTGGGAGTGTAGG GGG Intronic
900855187 1:5175907-5175929 GTGTGTGTTGGGAGTGGGGGTGG - Intergenic
901605693 1:10457409-10457431 CAAAGTGCTGGGAGTATAGGTGG - Exonic
901668449 1:10839629-10839651 CTGTGGGGTGGGAGTGGAGGTGG + Intergenic
901765780 1:11499209-11499231 CAGTGTGTTGGTGTTGCAGGGGG - Intronic
903460217 1:23515645-23515667 CAGAGTGCTGGGATTATAGGTGG + Intronic
904131310 1:28277475-28277497 CAAAGTGTTGGGATTATAGGCGG + Intronic
904272823 1:29361790-29361812 CAGAGTGTTGGGGGTTTATGGGG + Intergenic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904455147 1:30642991-30643013 CAGGGTTTTGTGAGTGGAGGAGG - Intergenic
904809936 1:33156935-33156957 CAGGGTGGTGGTAGTGGAGGGGG - Intronic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906454771 1:45984724-45984746 CAAAGTGTTGGGATTATAGGTGG - Intronic
907170440 1:52458578-52458600 CAGAGTGTTGGGATTATAGACGG - Intronic
907230076 1:52989351-52989373 CAATCTGTTGGGAGTGGAGGTGG + Intronic
907655380 1:56336863-56336885 CAGGGAGGTGGGAATGTAGGAGG + Intergenic
908454732 1:64292090-64292112 CAGTGTGTTGGTGGTGGACGGGG + Intergenic
908682400 1:66676804-66676826 GAGTGTGGTGTGAGTGTGGGTGG - Intronic
909209173 1:72800676-72800698 CAGTGTGATTAAAGTGTAGGTGG - Intergenic
910060674 1:83088024-83088046 CAGTGTTTTAGTAGTGAAGGAGG + Intergenic
910526901 1:88189946-88189968 CAGTGTGTGGGAAATGAAGGAGG - Intergenic
910565683 1:88640179-88640201 CAATGTGTTTGAAGTGTTGGTGG - Intergenic
910679139 1:89844191-89844213 CAGGGTGGTGGGAGGGTAAGGGG + Intronic
911018812 1:93365518-93365540 CTGGGTGTTGCGAGTATAGGAGG + Exonic
911425150 1:97700272-97700294 CAGAGTTTTGGAAATGTAGGAGG + Intronic
912439580 1:109688041-109688063 GTGTGTGTTGGGGGTGTGGGCGG + Intronic
913306817 1:117436754-117436776 CAGTGTGATTGGGGTGGAGGTGG + Intronic
913331905 1:117674758-117674780 AAGTGTTTTGGGAGTGTAGAAGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915587301 1:156851224-156851246 CACTGTTCTGGGAGTGTTGGAGG + Intronic
916380297 1:164202369-164202391 AAGTATATTGGGGGTGTAGGAGG + Intergenic
917143257 1:171859171-171859193 CAGCGTGGTGGGTGTCTAGGGGG - Intronic
918321576 1:183370064-183370086 CCGTGTGTTGGGAATGCAGGAGG - Intronic
918825650 1:189320421-189320443 CTGTGTGGTGTGTGTGTAGGGGG - Intergenic
919128973 1:193430866-193430888 CAGTGGGTTGGGACTGTACATGG - Intergenic
919282420 1:195508332-195508354 CAGTGTGTTGGTTTTGAAGGTGG + Intergenic
922073527 1:222219981-222220003 AAGTGTGTTGAGAGAGAAGGTGG - Intergenic
922311101 1:224391782-224391804 AAGTGTTTTGGGGGTGGAGGGGG + Intronic
923492413 1:234495741-234495763 TAGTGTGTTTGGGGTGGAGGTGG - Intergenic
1063242540 10:4186066-4186088 CAAAGTGCTGGGATTGTAGGCGG + Intergenic
1064014924 10:11764327-11764349 CAGAGTGCTGGGATTATAGGCGG - Intergenic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1066190913 10:33055293-33055315 CAGGGGGATTGGAGTGTAGGTGG - Intergenic
1066447314 10:35495387-35495409 AAGTGTGTTGGCAGCTTAGGTGG + Intronic
1066535884 10:36390868-36390890 GAGCATGTTGGGATTGTAGGTGG + Intergenic
1066643602 10:37581698-37581720 GAGCGTGTTGGGATTGTAGGAGG + Intergenic
1068523428 10:58102678-58102700 CACTGTCTGGGGATTGTAGGGGG + Intergenic
1071368599 10:84927424-84927446 CAGGGTGTAGGGATTGTTGGAGG + Intergenic
1071471715 10:85988184-85988206 CAGGGTATTGGGAGAGTAGTGGG - Intronic
1072641669 10:97215714-97215736 CAGGGCGTGGGGAGTGTTGGCGG + Intronic
1073996157 10:109317589-109317611 ATGTGAGTTGGGAGTGTGGGTGG - Intergenic
1074851215 10:117440952-117440974 CAAAGTGTTGGGATTATAGGTGG + Intergenic
1075486842 10:122829423-122829445 CAGACTGCTGGGAGTGTTGGCGG + Intergenic
1076059152 10:127400060-127400082 CAGTGTCCAGGGAGGGTAGGAGG - Intronic
1076300087 10:129419213-129419235 CAGTGTGTGGGCAGTGTGGAGGG - Intergenic
1077631420 11:3813630-3813652 CAGTGCTTTGGGAGTCGAGGTGG - Intronic
1077648110 11:3944453-3944475 CTGTGTAGTGGGAGTGGAGGGGG + Intronic
1078360455 11:10663790-10663812 CATTGTGCTGGGTGTGTAGTAGG - Intronic
1078450594 11:11437867-11437889 CAGGGTTCTGGGAGTGGAGGTGG + Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081561309 11:44219640-44219662 CAGTCTGTTGGGAATCCAGGAGG + Intronic
1081665146 11:44912280-44912302 CAGAGTGTTGGGATTCCAGGCGG + Intronic
1081984367 11:47290825-47290847 CAGTGTGTTTGGTGTGGTGGAGG + Intronic
1082018253 11:47509028-47509050 CAATGTGCTGGGATTATAGGGGG + Intronic
1083631284 11:64096820-64096842 CAGTGTGCTTGGAGGGTATGGGG - Intronic
1084173600 11:67412121-67412143 CAGTGTGTGGGGACTGAAGCTGG + Intronic
1084519125 11:69652429-69652451 CACTGTGGTGGCAGTGGAGGTGG + Exonic
1084985777 11:72870006-72870028 CAGTGGGGTGGGAGCATAGGGGG - Intronic
1085150303 11:74247252-74247274 TAGTGTGTTAGGAGTAGAGGCGG - Intronic
1085865243 11:80282954-80282976 CAGTCTGTTGGATGTGAAGGAGG + Intergenic
1086243062 11:84719906-84719928 CAGTGGGTTGGGGCTCTAGGTGG + Intronic
1087607406 11:100393524-100393546 CAGTATGTTTGGTGTGTTGGGGG - Intergenic
1087856070 11:103092728-103092750 CAGTGTGTTTTGGGTCTAGGGGG - Intergenic
1087959217 11:104326834-104326856 CAGGGTGTTAGTAGTGTAGGTGG + Intergenic
1088859320 11:113785246-113785268 TAGGATGTTGGGAGTGAAGGTGG - Intergenic
1089392517 11:118111766-118111788 CCGTGTGGTGGGTGTGGAGGAGG + Exonic
1089628215 11:119765145-119765167 CAGAGTGGTGGCAGTGGAGGTGG - Intergenic
1089831341 11:121330846-121330868 CATTGTGTTGGGGTTCTAGGAGG + Intergenic
1090527523 11:127553509-127553531 CAGTGTCTTTGGAGAGTATGGGG + Intergenic
1090847786 11:130545646-130545668 TAGGGTGTTGGGGGTGAAGGGGG - Intergenic
1090937283 11:131354317-131354339 CAGTGTGTTGGGGCAGCAGGGGG - Intergenic
1092856023 12:12674432-12674454 CAGGGTGATGGCAGTGTAGGTGG + Intronic
1092911506 12:13149115-13149137 CTGTGTGTGTGGTGTGTAGGAGG + Intergenic
1095328419 12:40926697-40926719 CAGAGTGGTGGCAGTGGAGGTGG + Intronic
1096255794 12:50061564-50061586 TTGTGTGTTGGGTGTGTTGGAGG - Intronic
1097239443 12:57565006-57565028 CAGTGTATTGAGAATGTTGGTGG + Intronic
1097324430 12:58259755-58259777 CAATGTGTTGGGGGTGGAGATGG - Intergenic
1097429159 12:59482036-59482058 AAGGGTGTGGGGAGAGTAGGAGG + Intergenic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098229246 12:68356053-68356075 CAAAGTGTTGGGATTATAGGTGG + Intergenic
1098386883 12:69929172-69929194 CAGTGTCTTGGGTATGTGGGTGG + Intronic
1098809221 12:75063573-75063595 CAGTGTGTTGAGGGTGATGGTGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1101172201 12:102109477-102109499 AAGGGTATTGGGAGTATAGGTGG + Intronic
1102603607 12:114052006-114052028 CAATGTGATGGTAGTGTAGGTGG - Intergenic
1102811061 12:115824375-115824397 CATTGGGTTGGAGGTGTAGGGGG + Intergenic
1103026492 12:117578330-117578352 CAAAGTGTTGGGATTGCAGGCGG - Intronic
1104188430 12:126454839-126454861 CTGGGTGTTGGGGGTGGAGGTGG - Intergenic
1104371598 12:128228508-128228530 CAGTGTGGTAGGAGTGAGGGAGG + Intergenic
1104908243 12:132226942-132226964 CAGTGTGTATGGGGTGTATGTGG - Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1108692362 13:52870948-52870970 CAGAGTGTAGGGAGTGCAAGAGG + Intergenic
1108904800 13:55455004-55455026 CAGTGTGTTTGAGATGTAGGCGG + Intergenic
1110464987 13:75790180-75790202 AACTGTGTTGGGGGTGGAGGGGG + Intronic
1110599590 13:77357026-77357048 AAATGTGTTAGGAGTGGAGGTGG - Intergenic
1112210739 13:97374698-97374720 CAGTTTGATGGGACTGGAGGGGG + Intronic
1112729862 13:102348792-102348814 CCGGGTGTTGGGTTTGTAGGAGG + Intronic
1112894535 13:104282949-104282971 CAAAGTGTTGGGATTGCAGGCGG - Intergenic
1113616742 13:111685657-111685679 CAGGCTGGTGGGAGTGCAGGTGG - Intergenic
1113622272 13:111770928-111770950 CAGGCTGGTGGGAGTGCAGGTGG - Intergenic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1113976286 13:114230176-114230198 CAGTGAGCTGGGAGTGCAGGTGG - Intergenic
1114967337 14:27979330-27979352 CAGTGAGCTGGGGCTGTAGGGGG - Intergenic
1115556190 14:34546656-34546678 CCGTGTGTTGAGAGTGTGGTGGG + Intergenic
1115557718 14:34556425-34556447 CCGTGTGTTGAGAGTGTGGTGGG - Intergenic
1116167581 14:41352699-41352721 CAGAGTCTGGGGAGGGTAGGGGG - Intergenic
1117116492 14:52518566-52518588 CAGGGTGATGGCAGTGGAGGTGG - Intronic
1117535690 14:56700973-56700995 CAGAGTGCTGGGATTGCAGGCGG - Intronic
1119261227 14:73239099-73239121 CAGTGTGTGTGGAGTGTCTGTGG - Intronic
1119317837 14:73710220-73710242 CAGTGTGTCAAGAGTGTAAGAGG + Intergenic
1119462996 14:74826744-74826766 CAGTCTGGTGGGACTGAAGGTGG - Intronic
1119706447 14:76785689-76785711 CTGTGTGGTGGCAGTTTAGGTGG - Intergenic
1119865874 14:77973479-77973501 AAGTATGTTGGTAGTGGAGGAGG + Intergenic
1119893303 14:78199309-78199331 CTGTGTGTTGGGTGTGGGGGGGG - Intergenic
1120097697 14:80407559-80407581 CAGTGTGTTACCAGCGTAGGTGG + Intergenic
1122242546 14:100378512-100378534 CTGTGTGTTGGGAGTGAAATGGG + Intronic
1202901159 14_GL000194v1_random:40581-40603 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1124328069 15:28783988-28784010 CAGGGTGCTGGGATTGCAGGAGG + Intergenic
1124656488 15:31513345-31513367 CCGTGTGGTGGTTGTGTAGGAGG - Intronic
1124962345 15:34408488-34408510 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1124978969 15:34554710-34554732 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125524011 15:40364153-40364175 GCGTGTGTTGGGGGTGGAGGTGG - Intronic
1128093090 15:64932155-64932177 CAAAGTGTTGGGATTATAGGCGG + Intronic
1128719082 15:69932841-69932863 CAACTTGTTGGGAGTGTTGGTGG - Intergenic
1129314496 15:74733090-74733112 CAGACTGCTGGGAGTGCAGGAGG - Intergenic
1129451961 15:75656180-75656202 CAGTGTGATGGGGGTGGGGGTGG + Intronic
1129968167 15:79755324-79755346 CAGTGTGTTGGTGGTGGAAGGGG + Intergenic
1133226492 16:4343249-4343271 CATTGTGATGGGCGTGCAGGTGG - Exonic
1133425285 16:5683132-5683154 GTGTGTGTTGGGGGTGGAGGTGG + Intergenic
1134426138 16:14147583-14147605 CAGTGTGTTTGGAGCGAGGGAGG + Intronic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1137513161 16:49119004-49119026 CAGAGTGGTGGGAGGGCAGGAGG - Intergenic
1137634408 16:49973486-49973508 AAGTGTGTTGAGAGTGCATGGGG - Intergenic
1138477190 16:57278596-57278618 CAGTAAGTGGGGAGTGTGGGGGG + Intronic
1139589386 16:67925064-67925086 CAGAGTGTTGGGATTATAGGCGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140231191 16:73118588-73118610 CAGTGTATTGGGTGTATTGGGGG + Intergenic
1140502521 16:75446236-75446258 CAGTGTGGTGGTAGTGGTGGTGG - Intronic
1140638135 16:76940676-76940698 CATTCTGTTGGGAGGGCAGGTGG - Intergenic
1141195635 16:81858762-81858784 CAGTGTCATGGGAGTCTAGATGG + Intronic
1141565416 16:84898393-84898415 CAGTGAGGTGGAAATGTAGGAGG - Intronic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1143805225 17:9420680-9420702 TAGTGGGTTGTGAGTGTATGAGG - Intronic
1144058549 17:11561527-11561549 CAGTGTCTTGGGAGTGTCTTGGG + Exonic
1144753552 17:17666387-17666409 GAGTGTGTAGGGTGTGCAGGTGG - Intergenic
1146446630 17:32937414-32937436 CAGTGAGTTGAGAGAGTGGGAGG + Intronic
1147816101 17:43211987-43212009 CTGTGTGTTGGGCGAGGAGGCGG - Intronic
1147892190 17:43725208-43725230 GAGTGTGTAGGAAGTGAAGGGGG + Intergenic
1148194102 17:45700942-45700964 AAGTGTGTTGGGGGTGGGGGAGG - Intergenic
1148229696 17:45924184-45924206 CAGGGGGTTGGGAGTCTGGGGGG - Intronic
1148554123 17:48567690-48567712 CAGAAAGTTGGGAGTGTTGGAGG - Intronic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1149300129 17:55297685-55297707 CAGGTTGGTGGGAGTGTAAGGGG - Intronic
1152044727 17:77928440-77928462 CAGGGTGTGGGGAGGGTAGTGGG + Intergenic
1152435790 17:80275139-80275161 GTGTGTGTTGGGAGTGTGTGTGG + Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152925158 17:83084314-83084336 CAGAGTGTTGGCAGTTTGGGGGG - Intronic
1154121051 18:11653045-11653067 CACTGTGGTAGGAGTGTAGGTGG - Intergenic
1154986141 18:21553026-21553048 CAATGTGTTGGGATTACAGGTGG - Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1157229241 18:45898720-45898742 AAGTGTTTTGGGGGTGTTGGTGG - Intronic
1157261420 18:46178569-46178591 CAAAGTGTTGGGATTATAGGCGG + Intronic
1157957938 18:52119728-52119750 CAGTGTGCTGGGATTACAGGTGG + Intergenic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1158783279 18:60677762-60677784 CAGGGTGTTGGCAGAGTTGGGGG + Intergenic
1159151286 18:64526963-64526985 AAGTGTGTTGGGAGTGGGGCAGG - Intergenic
1160085428 18:75772907-75772929 CAGGGTGTAGGGAGAGGAGGTGG - Intergenic
1160124250 18:76155817-76155839 CAGGGTGTTGGAAGGGTAGATGG - Intergenic
1160594459 18:79964392-79964414 GAGCGTTTTGGGGGTGTAGGTGG + Intergenic
1160761449 19:787457-787479 CAGTGTGCTGGGATTACAGGAGG + Intergenic
1160898586 19:1415215-1415237 CAGTGAGGTGGGGGTGGAGGGGG + Intronic
1161648046 19:5466586-5466608 CAGCTAGTTGGGAGTGCAGGTGG + Intergenic
1162566742 19:11448819-11448841 CTGTGTGTGGGGACTGGAGGAGG + Intronic
1162707440 19:12565702-12565724 CAGAGTGCTGGGATTATAGGCGG - Intronic
1163240330 19:16058857-16058879 CTGTGATTTGGGAGTGTAGAGGG + Intergenic
1164808082 19:31133075-31133097 GAGTAGGTTGGGGGTGTAGGTGG - Intergenic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165781920 19:38439766-38439788 CAGAGTGCTGGGATTATAGGTGG + Intronic
1167116159 19:47490233-47490255 CAGTGTGTTTTGTGTGTGGGGGG + Intronic
1167426712 19:49433353-49433375 CAAAGTGTTGGGATTGCAGGCGG + Intronic
1167576910 19:50322177-50322199 CAGTGGCTTGGGAGTCTAGGAGG - Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167939866 19:52937877-52937899 CAGTGTGCTGGGATTATAGGCGG - Intronic
1168300920 19:55404585-55404607 CAGTCTGTTGGCAGAGTTGGCGG - Intronic
1168486230 19:56764746-56764768 CAGGGTGTGGGGAGTTAAGGTGG - Intergenic
1168561429 19:57387059-57387081 CAGTGGGTGGGGAGTGTATCAGG - Intronic
1168670746 19:58239340-58239362 GAGTTTGGTGGGAGTGGAGGGGG - Intronic
925699455 2:6619263-6619285 CAGTGATTTGGTAATGTAGGTGG - Intergenic
925864583 2:8215500-8215522 CAAGGTGTTTGGAATGTAGGTGG - Intergenic
927152590 2:20204350-20204372 GAGTGTGTTGGGTGGGTCGGGGG + Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
929889995 2:45910929-45910951 GAGTGTCTTGGGTGTGTAGGAGG + Intronic
930152042 2:48069116-48069138 CAGGGGAATGGGAGTGTAGGCGG + Intergenic
930462211 2:51695673-51695695 CAGTGTGTGGGCAGTGTAATTGG + Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931237348 2:60422592-60422614 CAGTGATTTGGGAGTGAAAGGGG - Intergenic
932234916 2:70113166-70113188 CAGTGGGGTGGGAGTGGAGGTGG - Intergenic
932515684 2:72345891-72345913 CAGGGTGTTGATAGTGGAGGAGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933420780 2:82043078-82043100 ACGTTTGTAGGGAGTGTAGGTGG - Intergenic
935052635 2:99536602-99536624 CCCTGTGATGGGAGTGGAGGAGG + Intergenic
935195262 2:100810097-100810119 CAGGCAGTTGGGAGTGTGGGAGG + Intergenic
935492039 2:103733505-103733527 CAGTGTGGCGGGGATGTAGGTGG + Intergenic
936006224 2:108891681-108891703 CAATGGATTGGGTGTGTAGGTGG + Intergenic
937912045 2:127080512-127080534 AAGTGTGTGATGAGTGTAGGTGG - Intronic
939529789 2:143343555-143343577 CACTGTGTTGGCAGTGTGGGGGG + Intronic
940992433 2:160111301-160111323 CAGAGGGTTGGGAGTGTAGTTGG + Intronic
941385933 2:164851956-164851978 CACTCTGTTGGGAATGTAGATGG - Intergenic
942827972 2:180203692-180203714 CTGTGAGTTAGGAGTGTTGGAGG + Intergenic
943485846 2:188479537-188479559 CAAAGTGTTGGGATTATAGGCGG + Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944051008 2:195469745-195469767 ACGTGGGTTGGGAGTGGAGGAGG + Intergenic
944260130 2:197667948-197667970 CAGTGGGCTGGGTGGGTAGGAGG + Intronic
946480079 2:220046829-220046851 CAGAGTGTTGAGAGGGCAGGGGG - Intergenic
947429143 2:230010377-230010399 CAGTGGGGTGGGGGTGAAGGTGG + Intronic
947588159 2:231369853-231369875 CAGAGTGCTGGGATTATAGGCGG + Intronic
948132320 2:235609759-235609781 CTGTGAGTTGGGAGTGAAAGTGG - Intronic
1169373686 20:5048485-5048507 CAGAGTGTTGGGATTACAGGCGG + Intergenic
1169498188 20:6134490-6134512 CAGTGTGAGGGGTGTGGAGGGGG - Intergenic
1169914144 20:10671148-10671170 ACGTGTGTTTGGAGTTTAGGGGG - Intronic
1170627392 20:18040243-18040265 AAGTCTGTTGGGAGGGTGGGTGG + Intronic
1171530395 20:25849380-25849402 CAGCGTGGTGGGATTGTGGGTGG - Intronic
1171893221 20:30736010-30736032 AGGTGTGCTGGGAGTGGAGGGGG - Intergenic
1172286864 20:33746724-33746746 CAGCATGTTGGCAGTGGAGGTGG + Intronic
1172646701 20:36474731-36474753 CAGTGTGTGGGAAGGGTGGGGGG + Intronic
1172756776 20:37290718-37290740 CAGAGTGTTGGGATTATAGGCGG + Intronic
1175322086 20:58095379-58095401 TAGTGTGTTGGGAGGGGTGGGGG + Intergenic
1175593402 20:60211809-60211831 CACTGTGTTGGGAGAGCAGTGGG + Intergenic
1175906472 20:62382060-62382082 CAGTGTGTTGGTGGTGATGGTGG + Intergenic
1176245092 20:64093622-64093644 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245148 20:64093808-64093830 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245177 20:64093891-64093913 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245210 20:64093986-64094008 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245259 20:64094125-64094147 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245281 20:64094197-64094219 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245367 20:64094464-64094486 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176620533 21:9055359-9055381 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1178829381 21:36042840-36042862 CAGAGTGTTGGTATTATAGGCGG - Intronic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1180657022 22:17430498-17430520 GTGTGTGGTGGGAGTGGAGGTGG - Intronic
1181401488 22:22652576-22652598 GAGTGTGTGGGGGGTGTGGGGGG + Intergenic
1181644170 22:24221765-24221787 CAAAGTGCTGGGATTGTAGGCGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1185299588 22:50072463-50072485 GAGAGGGTTGGGAGTGTGGGTGG + Intronic
949265656 3:2153468-2153490 CAGTTTTATGGGAGTGTTGGAGG + Intronic
949271439 3:2222654-2222676 GTGTGTGTTGGGGGTGTGGGGGG - Intronic
949406113 3:3716511-3716533 CAGTGTGATGGTATTGGAGGTGG - Intronic
949837240 3:8282248-8282270 CAGTGCTTTGGCAGTGTAGCAGG + Intergenic
951517675 3:23579440-23579462 CAGTGCTTTGGGAGGCTAGGTGG + Intronic
951577803 3:24131582-24131604 CAGTGTGATGGTATTGAAGGCGG + Intronic
952216915 3:31287375-31287397 CAGTGTGTGGGGGCTGTGGGTGG + Intergenic
952379502 3:32793773-32793795 CAATGTGTTGGGATTACAGGCGG - Intergenic
953857899 3:46515325-46515347 TTGTATGTTGGAAGTGTAGGGGG - Intergenic
957177005 3:76824356-76824378 CAGAGTGCTGGGATTATAGGCGG + Intronic
957608280 3:82432535-82432557 CAGTGTGATGGCATTGGAGGTGG - Intergenic
959069244 3:101687230-101687252 CAAAGTGTTGGGATTATAGGCGG + Intergenic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
961494568 3:127282253-127282275 AAATGTTTTGGGAGTGGAGGAGG - Intergenic
961600184 3:128054406-128054428 TAGTGTGGTGGGATGGTAGGTGG + Intronic
962232687 3:133679281-133679303 CAAAGTGTTGGGATTATAGGTGG + Intergenic
962325541 3:134428941-134428963 CAGTGTGTTGAGAGTTTGTGAGG + Intergenic
962714720 3:138116023-138116045 CAGCAGGTTGGGAGGGTAGGGGG - Intergenic
964481120 3:157139337-157139359 CAGAGTGCTGGGATTATAGGCGG - Intergenic
967222899 3:187263462-187263484 GAGTCTGTGGGGATTGTAGGAGG + Intronic
968194422 3:196694933-196694955 TAGTGTGTGGGGTGTGTAGTGGG - Intronic
968346309 3:198012324-198012346 CAATGTGTTGGGATTACAGGCGG + Intronic
968470691 4:781170-781192 CAGGGCGTTGGCAGTGGAGGTGG - Intergenic
968949616 4:3683771-3683793 CAGGGTGTCAGGCGTGTAGGCGG - Intergenic
969290263 4:6234442-6234464 CGGAGTGTTTGGAGTGTATGTGG - Intergenic
969343898 4:6559504-6559526 TAAGGTGTTGGGAGTGTAGTTGG - Intronic
971391453 4:26189933-26189955 GTGTGTGTTGGGTGTGTTGGGGG - Intronic
971926326 4:33013710-33013732 CTGTGTGTTGGGGGTGGGGGAGG - Intergenic
974274886 4:59705844-59705866 CACTGTGTTGGGAGAGTAGGAGG + Intergenic
975732260 4:77348889-77348911 CAGTGTGTTGGGGGTGGGGGTGG + Intronic
976398378 4:84582334-84582356 CACTGTGTTGGGATCCTAGGTGG + Intergenic
977439192 4:97040596-97040618 CAGTGCTTTGGGAGGCTAGGTGG - Intergenic
978038913 4:104033666-104033688 CAGGGAGGTGGGAGTGTGGGAGG + Intergenic
981886774 4:149684773-149684795 AAGTGTGATGGGAATGCAGGGGG - Intergenic
984050312 4:174857355-174857377 AAGTGTGTTGGGGGTGGGGGGGG + Intronic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
985821959 5:2166547-2166569 GACTGTGGTGGGAGTGTGGGGGG + Intergenic
986535302 5:8780276-8780298 CAGAGGGTTAGGAGTGAAGGGGG + Intergenic
986806399 5:11312267-11312289 ATGTGTGTTGGGGGGGTAGGGGG - Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988814535 5:34821005-34821027 CCGTGTGTTGAGAATGTAGAGGG + Intronic
988996000 5:36715432-36715454 CAGTGTGTGGGGTGTGTGCGTGG - Intergenic
991585150 5:68194515-68194537 GTGTGTGGTGTGAGTGTAGGGGG + Intronic
991733480 5:69610836-69610858 AAGCGTGTTGGGGGTGTTGGTGG - Intergenic
991809914 5:70465982-70466004 AAGCGTGTTGGGGGTGTTGGTGG - Intergenic
991861474 5:71017014-71017036 AAGCGTGTTGGGGGTGTTGGTGG + Intronic
991966077 5:72092502-72092524 CACAGTGATGTGAGTGTAGGTGG - Intergenic
992550079 5:77851588-77851610 CTGTGTGGTGGGTGTGTAAGAGG + Intronic
994260730 5:97655628-97655650 CAGGATGATGGGAGTGGAGGTGG - Intergenic
994313429 5:98303915-98303937 AAGAGGGTGGGGAGTGTAGGGGG + Intergenic
994450748 5:99939536-99939558 CAGGGAGTTGGGACTGCAGGTGG + Intergenic
995000237 5:107119043-107119065 CAAAGTGTTGGCAGTATAGGCGG - Intergenic
996958399 5:129213030-129213052 CAGTGAGTTGGGAGTGCTAGGGG + Intergenic
998090023 5:139360224-139360246 CAAAGTGTTGGGATTATAGGCGG + Intronic
998786216 5:145711722-145711744 CTGTGTGTTGGGTGGGTTGGGGG + Intronic
999783054 5:154866365-154866387 CAGAGTGTTGGGATTACAGGTGG + Intronic
1000014959 5:157267796-157267818 CAGTGGGCTGGAAGTGGAGGTGG + Intronic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1001758006 5:174185697-174185719 CAGGGTGTGGGGTGTGTGGGGGG + Intronic
1002119908 5:176994969-176994991 CAGTGTGCTGGGAGAGTATCTGG + Intronic
1003847292 6:10186183-10186205 CAGTGTGTTGGGTGACTTGGAGG - Intronic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1006532154 6:34665192-34665214 CAGAGTGCTGGGATTATAGGCGG - Intronic
1006906600 6:37537269-37537291 CAGTGTCTGGGTAGTGGAGGAGG + Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008726806 6:54431453-54431475 CATTGAGTTGGGAGTCAAGGGGG + Intergenic
1009295022 6:61935681-61935703 CAGTGTGTTAGGATTGAATGAGG + Intronic
1009586353 6:65610153-65610175 CAGTGTTTTGGGAGTCTAAGGGG - Intronic
1010816736 6:80366698-80366720 AAGTGTGTTGGAAGTCTAGATGG - Intergenic
1011028011 6:82890637-82890659 CATAGTGTGGGGAGTGGAGGTGG - Intergenic
1011698421 6:89933722-89933744 CATAGTGTTGGGATTATAGGTGG - Intronic
1012279637 6:97313723-97313745 TAGTGTGTTGGGGGGGTAGGGGG - Intergenic
1013058509 6:106608996-106609018 CAGTGTGTGTGCAATGTAGGGGG - Intronic
1013292132 6:108728798-108728820 GAAAGTGTTGAGAGTGTAGGGGG + Intergenic
1013987414 6:116211887-116211909 CAGTGTGTTGTGTGTGTTGGGGG - Intronic
1014520460 6:122436148-122436170 CAGTGTGAAGACAGTGTAGGGGG + Intergenic
1015268611 6:131315894-131315916 CATGGTGTTGGGATTCTAGGGGG + Intergenic
1017204021 6:151785870-151785892 CTGTGTGTTGAGTGTGAAGGAGG + Intronic
1017320552 6:153087679-153087701 CTGTATGTTGGGTGTGTAGGAGG + Intronic
1017531713 6:155299329-155299351 GAGTGTGGTGGTAGAGTAGGTGG - Intronic
1018488601 6:164268888-164268910 CAGGGTTTGGGGAGTGGAGGAGG + Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020005867 7:4783527-4783549 TGGTGGGTTGGGAGTGTGGGGGG + Intronic
1020373218 7:7457302-7457324 CAGAATGTTGAGAGTGGAGGTGG + Intronic
1021468346 7:20971338-20971360 CAGTGTGTTGGGAGACCAGATGG + Intergenic
1022103355 7:27182175-27182197 CAGTGTGGTGGGTGGCTAGGAGG + Exonic
1022394067 7:29969997-29970019 CAGGGTGGTGGCAGTGGAGGTGG - Intronic
1022791475 7:33693461-33693483 GAGTTTGATGGGAGAGTAGGGGG + Intergenic
1022864623 7:34405084-34405106 GACTGTTTTGGGAGTGCAGGCGG - Intergenic
1023278158 7:38542692-38542714 CAAAGTGTTGGGATTATAGGAGG - Intronic
1023346048 7:39272299-39272321 AACTGTGATGGGAGTGGAGGAGG - Intronic
1024210048 7:47195373-47195395 CAGCGTGTAGGGTGTGTACGAGG + Intergenic
1024238825 7:47418025-47418047 CAGAGTGCTGGGATTATAGGCGG - Intronic
1024662067 7:51506295-51506317 CAGAGACCTGGGAGTGTAGGGGG - Intergenic
1026322844 7:69282540-69282562 CAAAGTGTTGGGATTATAGGTGG - Intergenic
1029174594 7:98655714-98655736 CAGGGTGCTGGCAGTGGAGGTGG + Intergenic
1029510237 7:100989952-100989974 CAAAGTGTTGGGATTATAGGTGG + Intronic
1029655131 7:101919144-101919166 GAGTGTGCTGGGTGTGCAGGAGG + Intronic
1030375709 7:108751057-108751079 GTGTGTGTTGGGGGTGTTGGGGG - Intergenic
1031460873 7:122047119-122047141 AAGTATGTTGGGAATGGAGGAGG + Intronic
1032135134 7:129269546-129269568 CAAAGTGTTGGGATTATAGGCGG + Intronic
1032297007 7:130648391-130648413 CAGTGTGTTGAGACTTTGGGGGG - Intronic
1032514148 7:132494582-132494604 CAGTGTGGTGGTGGTGGAGGTGG + Intronic
1032885980 7:136138786-136138808 CATTGTGCTGGGAGTGTGGATGG + Intergenic
1033641063 7:143263611-143263633 CAGTGTCTGGGGAGTGAGGGCGG + Intronic
1034261018 7:149755570-149755592 CAGTGTCTTGGGAGTCTGTGAGG + Intergenic
1035053732 7:156019872-156019894 CAGTGTGTTGGGGCTGTGGCTGG + Intergenic
1035161635 7:156954766-156954788 CAATGTGTTGGGATTACAGGCGG + Intronic
1035291350 7:157841251-157841273 GAGCGTGTGGGGAGTGAAGGCGG - Intronic
1035960331 8:4129374-4129396 TGGTGTGTTGGGGGTGGAGGTGG - Intronic
1037258941 8:16985674-16985696 GGGTGTGTTGGGTGTGTTGGGGG - Intergenic
1037885903 8:22596208-22596230 CAGTGTCATAGGAGTGGAGGGGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038414353 8:27383241-27383263 GCGTGTGTTGGGAGAGTGGGGGG - Intronic
1038695510 8:29803060-29803082 TAGTGTGTTTGGGGTGTGGGGGG + Intergenic
1039343347 8:36675081-36675103 CTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1039361694 8:36883980-36884002 CAGTGTGTTGGGTGTGGGGTTGG + Intronic
1039835789 8:41255355-41255377 CTTTTTGTTGGGAGGGTAGGTGG - Intergenic
1041706608 8:60852988-60853010 CAGAGTGGTGGGAGTGTGGACGG + Exonic
1042294338 8:67203450-67203472 CAGGGAGTTGGGAGTCCAGGAGG - Intronic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1042582876 8:70301390-70301412 CAAAGTGTTGGGAGTACAGGCGG - Intronic
1042867841 8:73371103-73371125 GACTGTGTTAGCAGTGTAGGGGG - Intergenic
1044489160 8:92791889-92791911 CAGTGGGTTGGAAGTGAATGGGG - Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1044719551 8:95132957-95132979 AAGTGTGTGTGGTGTGTAGGAGG - Intergenic
1044958398 8:97505320-97505342 CAGAGGGGTGGGAGTGTAAGTGG + Intergenic
1044968785 8:97599620-97599642 CATAGTGTTGGGAGTGTGGTGGG + Intergenic
1045688773 8:104738914-104738936 CTGTGTCTTGGGAGAATAGGAGG + Intronic
1046531038 8:115445136-115445158 CACTGAGCTGGGAGTGTATGAGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047619442 8:126591377-126591399 CAGAGTGTTGGAGGTGAAGGTGG + Intergenic
1047818859 8:128495959-128495981 CAGGGTATCTGGAGTGTAGGAGG - Intergenic
1051193875 9:14542437-14542459 CAGGGAGATGGGAGTGAAGGAGG - Intergenic
1051640809 9:19223014-19223036 CAATGTGTTGGGATTACAGGTGG + Intergenic
1051781212 9:20690804-20690826 CAGAGTGCTGGGATTATAGGCGG + Intronic
1051842532 9:21414571-21414593 AGCTGGGTTGGGAGTGTAGGGGG - Intronic
1052997275 9:34557881-34557903 GAAGGTGTTGGGAATGTAGGTGG + Exonic
1053024577 9:34719298-34719320 CAAAGTGTTGGGATTATAGGCGG + Intergenic
1054337850 9:63823487-63823509 CAGTGTGTGGGGAGTATGTGTGG - Intergenic
1054355414 9:64056711-64056733 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1054709210 9:68494347-68494369 CACTGGGCTGGGACTGTAGGAGG - Intronic
1055237022 9:74134124-74134146 CAGGGAGTTGGGCATGTAGGAGG - Intergenic
1056829386 9:89902594-89902616 CAGTGTGTGGAGTGTGTTGGGGG - Intergenic
1060063472 9:120482415-120482437 CACTGAGTTGGAAGGGTAGGAGG - Intronic
1060280510 9:122213005-122213027 CAGTGTGATGGGAGTGTCCAGGG - Intronic
1060399400 9:123339476-123339498 CAGAGAGTGGAGAGTGTAGGAGG + Intergenic
1060462226 9:123867724-123867746 GAGTGTGTTGGGGGAGCAGGGGG - Intronic
1060507667 9:124210108-124210130 AAGTGTCTTGGGGGTGGAGGGGG + Intergenic
1061179173 9:129013883-129013905 CAGTGAGCTGGGAGTGAAGGGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062664071 9:137657456-137657478 CAGGGTGTTGGGATTGTAGGTGG + Intronic
1203743743 Un_GL000218v1:25808-25830 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1203566366 Un_KI270744v1:93727-93749 AGGTGTGCTGGGAGTGGAGGGGG - Intergenic
1185791507 X:2930956-2930978 CTCTATGTTGGGTGTGTAGGTGG + Intergenic
1187362316 X:18640439-18640461 CAGGGTGTTGGGGGTGGGGGGGG - Exonic
1188197834 X:27260614-27260636 ATGTGTGTTAGGTGTGTAGGTGG - Intergenic
1188509973 X:30925231-30925253 CAGAGGATGGGGAGTGTAGGGGG + Intronic
1188665304 X:32812369-32812391 CAAAGTGCTGGGAGTATAGGCGG - Intronic
1189361162 X:40353134-40353156 CAGTGTTTTGGGAGGCTAAGTGG - Intergenic
1190157337 X:48004611-48004633 CAGTGTGTTGGGAGTGTAGGGGG + Intronic
1190173107 X:48127496-48127518 CAGTGTGTTGGGAGTGTAGGGGG + Intergenic
1192367511 X:70486486-70486508 TAATGTGTTGGGAGAGTAGAAGG - Intronic
1192389350 X:70709063-70709085 CAGTCTGTAGGAAGTGAAGGTGG - Intronic
1193734235 X:85137469-85137491 TAGGGTGGTGGCAGTGTAGGTGG - Intergenic
1195652289 X:107297709-107297731 GAGTATTTTGGGACTGTAGGCGG - Intergenic
1196777065 X:119348151-119348173 CAGAGTGGTGGGAGTGAAGATGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198202183 X:134433061-134433083 CAGTGTGCTGGGGATGCAGGGGG + Intergenic
1198233496 X:134715447-134715469 CAGTGTGTTAGGGGGGTGGGGGG - Intronic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1199606927 X:149585472-149585494 GTGTGTGTTGGGGGTGGAGGGGG + Intronic
1199632196 X:149783896-149783918 GTGTGTGTTGGGGGTGGAGGGGG - Intronic
1200278870 X:154759997-154760019 CATTGGGGTGGGAGAGTAGGAGG + Intergenic
1201157068 Y:11140789-11140811 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1201187727 Y:11420276-11420298 CGGTTTGTTGGGAATTTAGGTGG + Intergenic
1202082670 Y:21100849-21100871 CAAAGTGTTGGGATTGCAGGTGG - Intergenic