ID: 1190157895

View in Genome Browser
Species Human (GRCh38)
Location X:48008381-48008403
Sequence TGCATGGCTCATTATGAGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 2, 1: 0, 2: 2, 3: 5, 4: 127}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190157881_1190157895 14 Left 1190157881 X:48008344-48008366 CCTACTCCCTGCCTCCCTTCTCC 0: 2
1: 2
2: 26
3: 315
4: 2499
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157879_1190157895 27 Left 1190157879 X:48008331-48008353 CCCAAGCTCTATACCTACTCCCT 0: 2
1: 0
2: 1
3: 10
4: 163
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157889_1190157895 -7 Left 1190157889 X:48008365-48008387 CCCTGCCCCAGGGCTGTGCATGG 0: 2
1: 0
2: 4
3: 45
4: 436
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157891_1190157895 -8 Left 1190157891 X:48008366-48008388 CCTGCCCCAGGGCTGTGCATGGC 0: 2
1: 0
2: 4
3: 58
4: 465
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157883_1190157895 7 Left 1190157883 X:48008351-48008373 CCTGCCTCCCTTCTCCCTGCCCC 0: 3
1: 3
2: 36
3: 416
4: 2972
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157882_1190157895 8 Left 1190157882 X:48008350-48008372 CCCTGCCTCCCTTCTCCCTGCCC 0: 2
1: 3
2: 35
3: 467
4: 3368
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157888_1190157895 -1 Left 1190157888 X:48008359-48008381 CCTTCTCCCTGCCCCAGGGCTGT 0: 2
1: 1
2: 7
3: 103
4: 818
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157885_1190157895 3 Left 1190157885 X:48008355-48008377 CCTCCCTTCTCCCTGCCCCAGGG 0: 2
1: 2
2: 22
3: 179
4: 1255
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157880_1190157895 26 Left 1190157880 X:48008332-48008354 CCAAGCTCTATACCTACTCCCTG 0: 2
1: 0
2: 1
3: 21
4: 213
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127
1190157887_1190157895 0 Left 1190157887 X:48008358-48008380 CCCTTCTCCCTGCCCCAGGGCTG 0: 2
1: 3
2: 13
3: 109
4: 853
Right 1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG 0: 2
1: 0
2: 2
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190157895 Original CRISPR TGCATGGCTCATTATGAGAG TGG Exonic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
905215687 1:36405956-36405978 TGCCTGGCTAATTTTGAGATGGG + Intergenic
905307111 1:37027465-37027487 TGCATGACTGACCATGAGAGGGG - Intronic
907401727 1:54228740-54228762 TGAATGGATCATTAGGTGAGTGG - Exonic
908159466 1:61392522-61392544 GCCATGGCTCTTTATGAGGGTGG - Intronic
915908420 1:159896791-159896813 TGGATGGCTTATGAAGAGAGGGG - Intronic
917000095 1:170348128-170348150 TGCCTGGATCATTATCTGAGAGG - Intergenic
924670615 1:246120643-246120665 TGCGTGGCTCATAATGACATTGG + Intronic
1064901476 10:20300225-20300247 TGCTTTGATCCTTATGAGAGAGG - Intergenic
1065794402 10:29292524-29292546 TGCATGGCATATTATGAGAGCGG + Exonic
1065948155 10:30626236-30626258 TGCATGGCGTATTATGAGAGCGG - Exonic
1067692689 10:48512047-48512069 TGCATGACTGATTCTCAGAGAGG + Intronic
1068399930 10:56515243-56515265 TTAATGGTTTATTATGAGAGTGG - Intergenic
1069804893 10:71115786-71115808 GGCATGTCACATGATGAGAGAGG - Intergenic
1071365481 10:84895770-84895792 TTCATATCTCATTATGAGTGAGG + Intergenic
1071711455 10:88053889-88053911 TGCAGGGCTCATTAGGAGCCTGG + Intergenic
1072742494 10:97917802-97917824 TGCATGGCGCATTTCCAGAGGGG + Intronic
1074141467 10:110677207-110677229 TTAATGGGTTATTATGAGAGTGG - Intronic
1075907658 10:126095628-126095650 TTCATGGTTTATCATGAGAGTGG + Intronic
1079970783 11:27032393-27032415 AGCATGGCTCATGGTGATAGTGG - Intergenic
1084073803 11:66756489-66756511 TGCCTGGCTAATTATGGGTGAGG + Exonic
1085451779 11:76638533-76638555 TGCATGTCTCATCAGCAGAGAGG - Intergenic
1085837971 11:79976728-79976750 TGAATGGCTCATGGTGAGTGAGG - Intergenic
1086523315 11:87697085-87697107 TTCATGGCTCATGATGGGAGTGG - Intergenic
1089435687 11:118464053-118464075 TGGATGGCTCATTTTAAGAAGGG + Intronic
1090177970 11:124668390-124668412 TGCATGCCTCATTAAGGAAGAGG + Intronic
1090361003 11:126172628-126172650 TGCCAGGCTAATGATGAGAGTGG + Intergenic
1090924868 11:131240618-131240640 TGGATGAGTCATTATGAGAAGGG - Intergenic
1100417918 12:94397917-94397939 TGGATGGCCCATAATCAGAGTGG + Intronic
1101279730 12:103239967-103239989 TGAATGTCTCATTTTCAGAGTGG - Intronic
1101756726 12:107626809-107626831 TTCATGGTTAATTATTAGAGAGG - Intronic
1102509037 12:113402014-113402036 TGTCTGGCTCATTCTGGGAGCGG - Intronic
1103247531 12:119470842-119470864 TTCATGGTTCAGTAGGAGAGAGG - Intronic
1104648058 12:130511066-130511088 TGCATGGAGCATCCTGAGAGTGG + Intronic
1104857137 12:131907633-131907655 TCCTTGGCTCATTGTGAGATTGG + Intronic
1108516158 13:51204767-51204789 AGCATGGCACATGGTGAGAGAGG - Intergenic
1110130476 13:72002704-72002726 GGCATGTCTCATGGTGAGAGTGG + Intergenic
1110354465 13:74551243-74551265 TGCCTCGCACATTATCAGAGGGG - Intergenic
1110530296 13:76589776-76589798 TTCATACCTTATTATGAGAGTGG + Intergenic
1111977112 13:94977952-94977974 TGCTAGGCTCATTAGGACAGTGG - Intergenic
1114389705 14:22293882-22293904 AGCAGGGCTCCTTATGAGGGAGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1121812316 14:96902050-96902072 TGCATTACACATTATGTGAGTGG + Intronic
1126225708 15:46266847-46266869 AGCATGGCTCTTAGTGAGAGTGG + Intergenic
1126232507 15:46343779-46343801 GGCAGAGCTCTTTATGAGAGCGG + Intergenic
1127954758 15:63843832-63843854 AGCAGGGCTCACTAAGAGAGGGG - Intergenic
1130089762 15:80810852-80810874 TGGATGGCTGAATGTGAGAGTGG - Intronic
1130849243 15:87777756-87777778 TTCAGGGCACATTAGGAGAGTGG - Intergenic
1136472153 16:30488307-30488329 AGCATGGTTCATTAGGTGAGTGG + Intronic
1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG + Intronic
1138028546 16:53541189-53541211 TGCATGGGTGATGATGATAGTGG - Intergenic
1141460977 16:84178805-84178827 TGCTTGGCTCATCATCACAGTGG + Exonic
1144284329 17:13758218-13758240 TGGATGGCTCATAGTGAGATGGG - Intergenic
1150969577 17:70011630-70011652 GGCATGTCTCGTGATGAGAGAGG - Intergenic
1151431175 17:74064305-74064327 GGCATGTCTCATGGTGAGAGGGG - Intergenic
1153490867 18:5646653-5646675 TGCAATGCTCAGCATGAGAGTGG + Intergenic
1155741146 18:29289484-29289506 TGCATGTCTCAGTTTGAGAAGGG - Intergenic
1156472147 18:37384056-37384078 TGCATGGCTAATTGGGAGACTGG + Intronic
1158403481 18:57141243-57141265 GGCATGGCTCTTGGTGAGAGAGG - Intergenic
1162868990 19:13571497-13571519 TTCAGGGGTCATTATGAGATGGG - Intronic
931140384 2:59451789-59451811 TCAAAGGCTCATGATGAGAGAGG - Intergenic
932637747 2:73407227-73407249 TTAATGGCTTATCATGAGAGTGG - Intronic
935565081 2:104597827-104597849 TGCATGGGTCATTGGGGGAGCGG + Intergenic
936510410 2:113140752-113140774 CCCATGGCTCCTTATCAGAGAGG + Intergenic
936779864 2:116019121-116019143 TGTATGGCTCATTAAGAGTTAGG - Intergenic
939871191 2:147527618-147527640 TGGGTGGCTCATTATGATGGAGG + Intergenic
940661935 2:156557111-156557133 TGCAAGGCTAATTAAGAAAGTGG - Intronic
941634635 2:167923439-167923461 TTCATGTCTTATTATGAGTGAGG - Intergenic
941651541 2:168097574-168097596 TGCACGGCTAATTATGTGTGTGG - Intronic
942364738 2:175212901-175212923 AGCATGTCACATGATGAGAGAGG - Intergenic
944691198 2:202159999-202160021 TACAAGGCTCAATATGTGAGGGG - Intronic
946507671 2:220318727-220318749 TGCATGGCTCAGTGTGTGTGTGG - Intergenic
947340776 2:229136535-229136557 TGTATGGCTAAGTTTGAGAGGGG - Intronic
1170542748 20:17405467-17405489 TGAATGGCTGGTGATGAGAGAGG - Intronic
1172098393 20:32471829-32471851 GGCATGTCTCATGGTGAGAGAGG - Intronic
1178394922 21:32234709-32234731 TGCATGTCACATGATGAGAGAGG - Intergenic
1180656173 22:17422785-17422807 TGATGGGCTCATTAGGAGAGTGG - Intronic
950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG + Intronic
952597445 3:35035288-35035310 TCCATGGGGCATTATGCGAGTGG - Intergenic
956069082 3:65428851-65428873 TTCAGGTCTCCTTATGAGAGAGG - Intronic
957824140 3:85418948-85418970 TGTTTGGTTCATTTTGAGAGGGG + Intronic
958253869 3:91302033-91302055 AGCATGTCACATGATGAGAGCGG + Intergenic
960230892 3:115226155-115226177 TGCCTGGCTCATAAGGAGTGGGG - Intergenic
961955314 3:130795715-130795737 TGCATTCCTCATTAAGAGAGGGG - Intergenic
962621623 3:137185969-137185991 TGGGCTGCTCATTATGAGAGGGG - Intergenic
964389626 3:156183807-156183829 TCCCAGGGTCATTATGAGAGTGG + Intronic
967995413 3:195162533-195162555 TTCATGCTTCATTTTGAGAGGGG - Intronic
969834004 4:9824126-9824148 TGAATGGGTCATCATGGGAGTGG + Intronic
972642566 4:40938948-40938970 TTCATGGGTTATCATGAGAGTGG + Intronic
972727942 4:41762206-41762228 TACATGGCTCATTCTTAGTGAGG + Intergenic
973560789 4:52133216-52133238 GGCATGTCACATGATGAGAGAGG - Intergenic
973887608 4:55339125-55339147 GGCATGGCGCCTCATGAGAGAGG - Intergenic
978989174 4:115056620-115056642 TGGATGGTTCATTGTGAGAGTGG - Intronic
984944200 4:184958447-184958469 TTCATGGCTATTTATGAGGGTGG + Intergenic
985083646 4:186291876-186291898 TGCATGGCTTAAAATGAAAGGGG - Intergenic
988589623 5:32537553-32537575 AGCCTGGCTGATTGTGAGAGAGG + Intronic
988934991 5:36072837-36072859 TGCATGTCTTCTTATGAGAAGGG + Intergenic
989487711 5:42011323-42011345 TGCATTGGTTATTGTGAGAGTGG + Intergenic
989784253 5:45308156-45308178 TGCATGTCACATGATGAGAGAGG - Intronic
993482469 5:88440850-88440872 TAAATGGCTGATTATGAGATTGG - Intergenic
997856148 5:137374447-137374469 TGCATCGCTCATCATGGGAATGG - Intronic
998789883 5:145754751-145754773 TGCATAGCTCATTTTAAGAAGGG + Intronic
999347851 5:150840260-150840282 TGGATGGCTCAGTGAGAGAGGGG + Intergenic
1001778532 5:174347580-174347602 AGCATGACTCAGAATGAGAGGGG - Intergenic
1002014923 5:176313517-176313539 AGTCTGGGTCATTATGAGAGAGG - Intronic
1002658650 5:180774197-180774219 AGCATGTCACATGATGAGAGAGG + Intergenic
1003939293 6:11008502-11008524 TGCATGCCTAACTAAGAGAGGGG + Intronic
1005054795 6:21719476-21719498 CGCAAGTGTCATTATGAGAGAGG - Intergenic
1005270745 6:24160577-24160599 TCAATGGCTCATTATTAAAGAGG + Intergenic
1007252356 6:40504500-40504522 GTCATGACTCATTATGAGGGTGG + Intronic
1009212716 6:60882139-60882161 TGAAAGGCTCTTTTTGAGAGTGG + Intergenic
1013498752 6:110725771-110725793 TTCAAGTCTAATTATGAGAGGGG + Intronic
1014172841 6:118298031-118298053 GGCATGTCACATGATGAGAGAGG - Intronic
1016714303 6:147205319-147205341 TACATGGCTATTTATGAGAAAGG - Intronic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1019849441 7:3539571-3539593 TGCCTGGCTCATTAAGAGCAGGG + Intronic
1030507673 7:110445340-110445362 TGCTTGGCTGAGTCTGAGAGTGG - Intergenic
1032731460 7:134647125-134647147 TGCGAGGCTCATTCTGAGATAGG - Intronic
1033286658 7:140047322-140047344 TGTATGGGTTATCATGAGAGTGG + Intronic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1044107961 8:88235672-88235694 TGCATAGCTCTTTCGGAGAGGGG + Intronic
1044474862 8:92613978-92614000 GGCATTGCTCACTCTGAGAGCGG + Intergenic
1045255994 8:100522598-100522620 GGCATTGCTTATTATGTGAGTGG - Exonic
1047160566 8:122373906-122373928 AGCATAGCTCATCATGGGAGAGG + Intergenic
1049676413 8:143891233-143891255 TCCAGGGCTGATTTTGAGAGTGG - Intergenic
1050074979 9:1853888-1853910 GGCATGTCTCATGGTGAGAGAGG - Intergenic
1051707026 9:19891526-19891548 AGCATGTCACATTGTGAGAGAGG + Intergenic
1058979385 9:110155251-110155273 TGCATGGCTCCGTTTGGGAGGGG - Intronic
1186880739 X:13863581-13863603 CCCAAGGCTCATTATGAGAAAGG + Intronic
1186953853 X:14658467-14658489 TGCATTGCTTATGATGAGGGAGG - Intronic
1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG + Exonic
1190173667 X:48131266-48131288 TGCATGGCTCATTATGAGAGTGG + Exonic
1193627207 X:83836571-83836593 TGCATGTCACATGATGAGACAGG + Intergenic
1195448284 X:104978086-104978108 TTCTTGGCTCATTATGAGGTAGG - Intronic
1196315153 X:114213640-114213662 GGCATGCCACATGATGAGAGAGG + Intergenic
1199149730 X:144416229-144416251 TGCATGGAGTATTATGAGAAAGG - Intergenic