ID: 1190159463

View in Genome Browser
Species Human (GRCh38)
Location X:48020736-48020758
Sequence AGCACCGACGGCTTTGGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190159463_1190159467 -1 Left 1190159463 X:48020736-48020758 CCGTTCCCAAAGCCGTCGGTGCT No data
Right 1190159467 X:48020758-48020780 TAGCAGCCAAAGTTGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190159463 Original CRISPR AGCACCGACGGCTTTGGGAA CGG (reversed) Intronic