ID: 1190160806

View in Genome Browser
Species Human (GRCh38)
Location X:48030204-48030226
Sequence CAGCAGATGTATTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190160799_1190160806 8 Left 1190160799 X:48030173-48030195 CCAGAACTGCAGCCTCCCACACG 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 173
1190160800_1190160806 -4 Left 1190160800 X:48030185-48030207 CCTCCCACACGCCCAACTGCAGC 0: 1
1: 0
2: 3
3: 23
4: 287
Right 1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 173
1190160802_1190160806 -8 Left 1190160802 X:48030189-48030211 CCACACGCCCAACTGCAGCAGAT 0: 1
1: 0
2: 2
3: 17
4: 133
Right 1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 173
1190160798_1190160806 9 Left 1190160798 X:48030172-48030194 CCCAGAACTGCAGCCTCCCACAC 0: 1
1: 1
2: 2
3: 33
4: 286
Right 1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 173
1190160801_1190160806 -7 Left 1190160801 X:48030188-48030210 CCCACACGCCCAACTGCAGCAGA 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190160806 Original CRISPR CAGCAGATGTATTTGGATTC TGG Intronic
904336128 1:29799541-29799563 CAGGAGATGTGTACGGATTCAGG + Intergenic
906969177 1:50492815-50492837 TAGAAGATGTATTAGGCTTCAGG - Intronic
910043519 1:82883932-82883954 CAGCTGAAGTTTTTGGATTTGGG + Intergenic
912496044 1:110092340-110092362 CAGCAGAGGTCAGTGGATTCTGG - Intergenic
915235982 1:154482610-154482632 CAGCAGATGTGTCTGTATTCTGG - Exonic
915667376 1:157457334-157457356 CAGGAGATGTGTATGGGTTCAGG - Intergenic
915819128 1:159003337-159003359 CAATAGATGTATTTTTATTCTGG + Intronic
916285626 1:163101855-163101877 CAGAAGATGTGTATGGGTTCAGG + Intergenic
917764831 1:178204305-178204327 CAGGAGATGCATATGGGTTCAGG + Intronic
919324804 1:196093371-196093393 CAACATATGTATTTCAATTCAGG - Intergenic
919612370 1:199760936-199760958 CAGTATCTGTATTTGAATTCTGG - Intergenic
1063187730 10:3665866-3665888 CTGCACATGGATTTGGATTTTGG + Intergenic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1069314505 10:67080464-67080486 CAGTAGATGTATTGCGATGCTGG - Intronic
1071171139 10:82865665-82865687 CAGAAGTTGTATTTGGCTCCTGG + Intronic
1082922518 11:58510837-58510859 CAGCAGCAGGATTTGGATTCAGG - Intergenic
1083093432 11:60223459-60223481 CAGGAGATGTGTGTGGGTTCAGG + Intronic
1085070199 11:73536828-73536850 CAACAGATATCTTTGGAATCAGG - Intronic
1086240740 11:84687212-84687234 CAGCAGATGTAGTTAGAATTTGG - Intronic
1086920781 11:92583890-92583912 CAGATGAAGTATTTGGATTGGGG + Intronic
1092507575 12:9119748-9119770 CAGCAGATGTATTAAGAATGTGG + Intergenic
1092741070 12:11630152-11630174 CAGCAGATGGATTATGATTAGGG - Intergenic
1093049366 12:14488668-14488690 TAGGAGATGTATATGGGTTCAGG - Intronic
1094122666 12:26990516-26990538 CAGCAGATGTATTTAGAAACGGG + Exonic
1095495517 12:42779768-42779790 CCACAGATGTATTTGTCTTCTGG + Intergenic
1096357478 12:50953312-50953334 AAGCCGCTGTATTTGAATTCTGG + Intergenic
1097588393 12:61542828-61542850 TAGCAGCTGTGTTTGGAATCAGG - Intergenic
1097918968 12:65051350-65051372 CACCAGATGTAATTGGATTCAGG + Exonic
1099366212 12:81767705-81767727 CAGGAGATGTGTATGGGTTCAGG + Intergenic
1099966746 12:89454919-89454941 CAGCAGATGTGGTGGGATCCAGG - Intronic
1101264433 12:103068441-103068463 CAGGAGATGTGTATGGGTTCAGG + Intergenic
1101823970 12:108206282-108206304 CAGCCGATGTACTTGGCTTTGGG - Exonic
1104042536 12:125139867-125139889 CAGCAGATGCTTTTGGTGTCTGG + Intronic
1104547620 12:129726385-129726407 CAGGAGGTGCATTTGGATTGGGG + Intronic
1104577314 12:129979761-129979783 CAGCAGGTGTATTTGGATACTGG + Intergenic
1106410675 13:29509169-29509191 CTGCAGATTTATTTGGCTTTGGG - Intergenic
1107715064 13:43191837-43191859 CAGCAGCTGTATTTGGAACTGGG + Intergenic
1107866190 13:44705645-44705667 CTGCAGATATAGTTTGATTCTGG - Intergenic
1107901276 13:45017142-45017164 CAGGAATTGTATTTGGTTTCAGG + Intronic
1110168393 13:72471070-72471092 CAGCAGATCTATATGGTCTCCGG - Intergenic
1111057499 13:82970707-82970729 CAGGAGACGTATATGGGTTCAGG - Intergenic
1111931383 13:94516360-94516382 CACCAGATGTATTTCTTTTCTGG - Intergenic
1113387500 13:109862580-109862602 CAGCTGATCTATTTGAATTCGGG + Intergenic
1113640637 13:111954483-111954505 CGGCAGATGTGTTTGTATTTGGG - Intergenic
1115102319 14:29717404-29717426 CAGCAGATGGATCAAGATTCAGG + Intronic
1116415369 14:44671685-44671707 CAGGAGATGTGTATGGGTTCAGG + Intergenic
1118233410 14:63976048-63976070 GAGGAGATGTACTTGGATTTGGG + Intronic
1121227696 14:92333574-92333596 CAGAAGATGTATTTGGAAGAAGG - Intronic
1124717304 15:32076472-32076494 CAACAGATTTATTTAGATTAAGG + Intronic
1125261128 15:37825875-37825897 CTGAAAATGTATTTGTATTCAGG - Intergenic
1125350189 15:38758517-38758539 TAGCAGAGGGATTTGGACTCGGG + Intergenic
1125914797 15:43476295-43476317 AAGCAGAAGTATAAGGATTCTGG - Intronic
1126280934 15:46948513-46948535 GAGCAGGGGGATTTGGATTCAGG - Intergenic
1127300202 15:57645386-57645408 CTGCAGATGCATGTGGATTTAGG - Intronic
1127783300 15:62334900-62334922 CTGCAGCTGTATCTGGATTAGGG + Intergenic
1128750530 15:70145646-70145668 CAGCGGTAGTATTTGGATACTGG - Intergenic
1128900906 15:71422377-71422399 CTGCAGACGTATTTGCATTAGGG + Intronic
1135854120 16:25991202-25991224 CAGCAGATGTGTTTATATGCAGG + Intronic
1138772545 16:59683166-59683188 CAGGAGATGTATTTTGCTTGAGG - Intergenic
1138831486 16:60380295-60380317 AAGAAAATGTGTTTGGATTCTGG + Intergenic
1143541136 17:7570028-7570050 GAGGAGCTGTATTTGAATTCTGG + Intronic
1144397008 17:14854203-14854225 CAGGAGATGCATTCTGATTCTGG + Intergenic
1144568274 17:16378776-16378798 AGGCAGATGTGTTTGGATCCTGG - Intergenic
1145510740 17:24116184-24116206 CAGAAGATGTCTTTGGAAACGGG + Intergenic
1146625299 17:34430808-34430830 CAGCATATGAATTTGGACTGAGG - Intergenic
1146836591 17:36115825-36115847 CAGGAGATGTGTATGGGTTCAGG + Intergenic
1149075541 17:52593714-52593736 CAGCAGCTGTATCTGTATTAGGG + Intergenic
1149348510 17:55763689-55763711 CAGTAGATATTTTTGGATTATGG + Intronic
1149686835 17:58540597-58540619 CAGGAGATGGATTTGGATTGTGG + Intronic
1151119435 17:71776012-71776034 CATAAGCTGTATTTTGATTCTGG - Intergenic
1152884045 17:82838033-82838055 CAGCCGATGCACTTGGCTTCTGG + Intronic
1158650167 18:59276913-59276935 TAGCAGATGTATTTTAATCCTGG + Intronic
1160347179 18:78142112-78142134 CAGCATATGTATTTAGAGTTCGG + Intergenic
1162041875 19:7975659-7975681 CGGCATATGAATTTGGATTGTGG - Intronic
1163934034 19:20425056-20425078 CAGAAGATGTAATCAGATTCTGG + Intergenic
1164026595 19:21358842-21358864 CAGAAGATGTAATTAGATGCTGG - Intergenic
1165873953 19:38992589-38992611 CTGCAGCTGTGTCTGGATTCTGG + Intronic
926396188 2:12445310-12445332 ATGAAAATGTATTTGGATTCTGG - Intergenic
926599337 2:14825065-14825087 CAGTAGATATATTTGGCATCTGG + Intergenic
927009010 2:18882026-18882048 CAGGAGATGTGTATGGTTTCTGG + Intergenic
927416798 2:22888511-22888533 CAGAAGATGTTTGAGGATTCAGG - Intergenic
928192869 2:29189685-29189707 AAGGAGATGCATTTGAATTCAGG - Intergenic
928289079 2:30021573-30021595 CTGCAGAAGTTCTTGGATTCAGG - Intergenic
930818114 2:55619523-55619545 CAGCAGATGTTCTTTGCTTCAGG + Intergenic
933281021 2:80332849-80332871 CAGCAGCTGAATTTGGCTTTAGG - Intronic
942487512 2:176455167-176455189 CAGCAGCTGCATTAGGTTTCTGG - Intergenic
943641922 2:190369070-190369092 AAACAAATGTGTTTGGATTCAGG - Intronic
945261995 2:207852224-207852246 AGTCAGATGTATTTGGATTCAGG + Intronic
1169578814 20:6995941-6995963 CAGGAGATTTATTTTGAATCAGG + Intergenic
1173180784 20:40804832-40804854 GAGAAGATGGATTTGGATTATGG - Intergenic
1177372866 21:20228366-20228388 AAGCAGATGTAATTGTTTTCAGG - Intergenic
1177446181 21:21199178-21199200 CAGGATATTTTTTTGGATTCAGG + Intronic
1178063723 21:28880190-28880212 CAGCACATATATTTATATTCTGG + Intronic
1179091188 21:38267220-38267242 CAGGAGATGTAGCTGGATTTAGG + Intronic
1179255736 21:39713700-39713722 CAGCAGACTTCTCTGGATTCTGG - Intergenic
1181036968 22:20174411-20174433 CAGCAGATGTAGATGCATGCGGG + Intergenic
1183075416 22:35423569-35423591 GAGCAGAGGTGGTTGGATTCTGG + Intronic
1183412665 22:37664495-37664517 CAGCAAAAGGATTTGCATTCGGG - Intronic
1184717189 22:46288897-46288919 CAGCAGGTGTCTCTGGCTTCAGG - Intronic
949612941 3:5721661-5721683 CAGCAGAACTATCTGGATCCAGG + Intergenic
950202867 3:11057217-11057239 CAGAAGATGTGTTTTGATTGGGG - Intergenic
952131950 3:30374247-30374269 CAGCCCCTGTAATTGGATTCAGG + Intergenic
952175429 3:30857671-30857693 CATCAGATGTATTTGAATAGAGG - Intronic
952448122 3:33403444-33403466 CAGTTGATGTATTTTGATGCTGG - Intronic
952886553 3:38015966-38015988 CAGCAGAGCTATTTGGGCTCTGG + Intronic
953422387 3:42764622-42764644 CAGCAGATGTTTTGGGTTTGTGG + Intronic
953477601 3:43218904-43218926 TGGCAGGTGTGTTTGGATTCAGG + Intergenic
955839332 3:63095769-63095791 CAGCTCATGTTTTTGGGTTCTGG - Intergenic
957178897 3:76850673-76850695 CACCAGCTGTATTTGAATCCTGG + Intronic
959729188 3:109581612-109581634 AGGCAGATGTATTTGGATTGGGG - Intergenic
959977087 3:112472956-112472978 CAGCAGATCTGTTTGTATTAGGG - Intronic
963630593 3:147725549-147725571 CAGGAGATGTGTATGGGTTCCGG + Intergenic
965166243 3:165196662-165196684 CGGCTGATGGATTTGCATTCAGG - Intronic
965995927 3:174883341-174883363 CAAGAGATGTGTATGGATTCAGG - Intronic
966562523 3:181339046-181339068 CAGCAGATATATTTATATGCTGG - Intergenic
971972779 4:33641678-33641700 CTGCAGTTTGATTTGGATTCTGG + Intergenic
973717275 4:53689658-53689680 TAGAAGATGTATTTGAATTGAGG - Intronic
978283016 4:107039483-107039505 CAGCAGTTGTTTCTGGATCCTGG + Intronic
978771850 4:112465494-112465516 CAGGAGATGTGTATGGGTTCAGG - Intergenic
985399371 4:189579336-189579358 CAGCAGAGTTATTTAGAGTCAGG + Intergenic
988232729 5:28501827-28501849 CAGGAGATGTGTATGGGTTCAGG - Intergenic
991037994 5:62147101-62147123 CAGAAGATATATTTGGCTTCAGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993412291 5:87589478-87589500 CAGGAGATGTGTATGGGTTCAGG - Intergenic
995291018 5:110453639-110453661 CAGCAGATGTATTTTAGTTTGGG + Intronic
997297176 5:132775758-132775780 CAGCAGGTCTGTTAGGATTCAGG + Intronic
999465971 5:151805114-151805136 CAGCATTTGTATTTTTATTCTGG + Exonic
1000393487 5:160749072-160749094 AAGAACATGGATTTGGATTCAGG - Intronic
1000554602 5:162710330-162710352 CATCAGATGTTTTTTGATACAGG - Intergenic
1001269940 5:170303374-170303396 CAGCAGAGCTATCTGGGTTCAGG - Intergenic
1003695944 6:8406453-8406475 TAGCAGGTGTATTTGGATTTTGG - Intergenic
1003934813 6:10964434-10964456 TTTCAGATGTTTTTGGATTCTGG + Intronic
1007003604 6:38337958-38337980 CAGCAGGTGAATATGGACTCCGG + Intronic
1011617858 6:89213308-89213330 CAGCTTATGGATTTGGAGTCTGG + Intronic
1012682914 6:102205524-102205546 CAGAATATATATTTGGATTGTGG - Intergenic
1012982473 6:105844648-105844670 CAGCAAGTGAAGTTGGATTCAGG + Intergenic
1013684582 6:112564720-112564742 CAGCAGATGATTTTGTTTTCCGG + Intergenic
1013771975 6:113638019-113638041 CAGGAAATGTATTTTGATTATGG - Intergenic
1014078189 6:117261876-117261898 CAGGAGTTGTGTTTGGATTTGGG - Intergenic
1014456011 6:121635842-121635864 CAGGAGATGTGTGTGGGTTCAGG + Intergenic
1014533859 6:122593988-122594010 CAGGAGATGTGTATGGGTTCAGG - Intronic
1016239457 6:141912018-141912040 CTCAATATGTATTTGGATTCCGG + Intergenic
1017207219 6:151816322-151816344 CAGCAGCTATATTTCTATTCTGG + Intronic
1017344385 6:153363098-153363120 CTCCAGATGTTTTTGGATTTGGG + Intergenic
1017380155 6:153818934-153818956 CAGCAGATGTTTTGGGGTTTGGG - Intergenic
1017558754 6:155604234-155604256 CAGGAGATGTGTATGGGTTCAGG - Intergenic
1018158603 6:161014604-161014626 AAGCACATATATTTGAATTCTGG + Intronic
1018331316 6:162730343-162730365 CTGAAGGTGTATTTTGATTCAGG + Intronic
1018629284 6:165808308-165808330 CAGCAGATGGATGTGACTTCTGG - Intronic
1022238585 7:28487413-28487435 CAGATGATGTATTTGGATCAAGG + Intronic
1024699985 7:51896396-51896418 CAGCAGCTGTATTTGCTGTCTGG - Intergenic
1027406766 7:77870727-77870749 CAGGAGATGTGTATGGGTTCAGG - Intronic
1028548882 7:92034376-92034398 CTGCAGATGTAACTGGATACAGG + Intronic
1028934636 7:96451475-96451497 CAGGAAATGGCTTTGGATTCGGG - Intergenic
1029125098 7:98290130-98290152 GAGCAGATGTATGTGGCTTGTGG + Intronic
1031016038 7:116577619-116577641 AAGCAGATGTATCAGTATTCTGG + Intergenic
1031799706 7:126226619-126226641 CAGCTGCTGTTTCTGGATTCTGG + Intergenic
1033950403 7:146778333-146778355 TAGCAGATGGATTTGTATTGTGG - Intronic
1035845413 8:2858867-2858889 CAGGAGTTGTTTTTGGACTCAGG - Intergenic
1037019112 8:13946172-13946194 CATCTGATGCACTTGGATTCAGG + Intergenic
1037477527 8:19271784-19271806 CAGAAGATGTATTTAAATCCCGG - Intergenic
1038206786 8:25474851-25474873 CCACAGATGTGTGTGGATTCGGG + Intronic
1042193764 8:66214280-66214302 CAAAAGATGTATTTTGATTGAGG - Intergenic
1042843304 8:73146585-73146607 CAGCAGATGTGCTTGGCTTCTGG - Intergenic
1043302295 8:78748916-78748938 AAGCAGATATATTTGTTTTCAGG + Intronic
1044241610 8:89894078-89894100 CCGCAGCTGTATCTGGATTAGGG - Intergenic
1044692300 8:94893703-94893725 CTGCAGCTGTAGTAGGATTCGGG + Intronic
1045426672 8:102073911-102073933 CACTAGATGTTTTTGGAATCTGG + Intronic
1046706513 8:117459062-117459084 AAGCAGATGGAATTGGATTGGGG + Intergenic
1047042142 8:121007839-121007861 CAGCTGATGCATTGGGATGCAGG + Intergenic
1047188646 8:122657999-122658021 CAGCCCATGTATTGGGATTGGGG - Intergenic
1047562229 8:125999938-125999960 CAGCATATGAATTTGGGTTGGGG - Intergenic
1048108880 8:131444133-131444155 CAGCAGATGTACTGAGATACTGG + Intergenic
1048117581 8:131542570-131542592 CAGCAGATCTATTTTGCTGCAGG + Intergenic
1048142790 8:131811139-131811161 CAGCAGATGAATTTGGGGTGGGG - Intergenic
1048520087 8:135145806-135145828 CCACAGATGTTTATGGATTCTGG + Intergenic
1050574942 9:6985070-6985092 CAGCAGAGGGAGTCGGATTCTGG - Intronic
1051653742 9:19356978-19357000 CACCAGAGGTACTTGGTTTCAGG - Exonic
1058609111 9:106755819-106755841 TAGCAGGTGTGTTTGGAATCTGG + Intergenic
1058668843 9:107343715-107343737 CAGCAGAGTGATATGGATTCTGG + Intergenic
1186745152 X:12560193-12560215 AAGCAGAAGTATTTGAATACAGG - Intronic
1189921440 X:45906674-45906696 CAGCAGAAGCATGAGGATTCAGG - Intergenic
1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG + Intronic
1190620165 X:52279382-52279404 TTGCAGATGTATTTGGATACTGG - Intergenic
1193873325 X:86829147-86829169 AAGCATAAGCATTTGGATTCTGG + Intronic
1194692032 X:96998996-96999018 CAGCAGATATTTTTGAATCCAGG + Intronic
1197585997 X:128349142-128349164 CTGCAAAAGTGTTTGGATTCTGG + Intergenic
1201944398 Y:19496277-19496299 CAGCAGAAGCATTTGAATGCTGG + Intergenic