ID: 1190165769

View in Genome Browser
Species Human (GRCh38)
Location X:48071721-48071743
Sequence AGGCTGGACAGAGCACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190165756_1190165769 28 Left 1190165756 X:48071670-48071692 CCTGAGCAAAGGCGTGGCGACAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1190165769 X:48071721-48071743 AGGCTGGACAGAGCACCCCCCGG 0: 1
1: 0
2: 1
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190165769 Original CRISPR AGGCTGGACAGAGCACCCCC CGG Intergenic
900434664 1:2623736-2623758 AGGCTGGAGAGAGCCTCCCTTGG + Intronic
900619578 1:3580651-3580673 AGGCTGGACCGGGTGCCCCCCGG + Intronic
900625098 1:3604347-3604369 AGGCAGGGCAGAGCTCCTCCTGG + Intronic
900633835 1:3652303-3652325 AGGCGGGGCAGAGCGCGCCCGGG + Intronic
900784450 1:4638934-4638956 AGGAAGGACAGAGAACCCCCGGG + Intergenic
900854079 1:5166743-5166765 AGGCTGGTCAGAGCACAGCTTGG + Intergenic
900923215 1:5686955-5686977 AGGCCGGACAGAGCAGCCCAGGG + Intergenic
901323156 1:8351457-8351479 AGGCTGGCCACAGGAGCCCCAGG - Intergenic
902373278 1:16018231-16018253 AGGCTGATCACAGCAGCCCCAGG + Exonic
905031028 1:34884826-34884848 AGGGTGGTCAGAGCAGCCACAGG - Intronic
906667434 1:47631762-47631784 AGGCTGGACAGAGAACTCCGTGG + Intergenic
907268122 1:53275119-53275141 AGGCTGGACTGATCATCTCCTGG + Intronic
907319047 1:53591319-53591341 AGGCTTGTCAGAGCCTCCCCTGG - Intronic
910870707 1:91830395-91830417 ACCGTGGACAGAGCTCCCCCTGG - Intronic
912717598 1:111992846-111992868 AGCCTGAACAGAGCAGCCCTGGG - Intergenic
915049136 1:153049351-153049373 AGTCTGACCTGAGCACCCCCTGG + Intergenic
915267481 1:154729296-154729318 AAGTTGGACAGAGCACATCCAGG - Intronic
915426545 1:155831947-155831969 AGGCTGGACAATGCAAACCCAGG + Intronic
921337889 1:214107136-214107158 ATGCAGTACAGAGGACCCCCTGG + Intergenic
922728977 1:227940282-227940304 AGGCTGCACGCAGGACCCCCCGG + Intronic
922820550 1:228482422-228482444 AGGCTGGACAGAGAAGTGCCAGG + Intergenic
922854197 1:228760228-228760250 AGGCTGGACAGGGCAACCTCTGG + Intergenic
1062901042 10:1147418-1147440 AGGGTGGACAGTGCTTCCCCAGG + Intergenic
1065025274 10:21534740-21534762 AGGCTGGGCCGAGAACCCGCTGG + Exonic
1067828482 10:49596544-49596566 AGACTGCACAGTGCACACCCGGG + Intergenic
1071940469 10:90586160-90586182 AGACGGGACAGGGCCCCCCCAGG + Intergenic
1075106643 10:119543505-119543527 GTGCGGGACAGAGCACCGCCCGG - Intergenic
1076571903 10:131438667-131438689 AGGCTGGAGACAGTCCCCCCGGG + Intergenic
1076751869 10:132547325-132547347 AGGATGGAGAGAGCCCCTCCAGG - Intronic
1076774199 10:132685274-132685296 AGGCTCCACAGAGATCCCCCTGG + Intronic
1076777414 10:132705385-132705407 AGGCTGGCCAAGGCATCCCCAGG - Intronic
1077116841 11:889035-889057 CAGCTGGGCAGTGCACCCCCAGG - Intronic
1077186299 11:1236846-1236868 AGGCAGCACAGAGCCCACCCTGG - Intronic
1077385079 11:2265485-2265507 AGCCTGGACAGAGCCTCACCTGG - Intergenic
1077488132 11:2848388-2848410 AGGGGAGACAGAGCAACCCCTGG + Exonic
1077718061 11:4600931-4600953 AGGCTGGATGGAGCACCCAGAGG + Intronic
1077994976 11:7445360-7445382 AGGCTGGACAGTGAAGCCCAGGG - Intronic
1078154624 11:8788609-8788631 AGGGTGGAGAGAGCGCCCTCAGG - Intronic
1083201433 11:61123321-61123343 AGGCTGTACTGAACACCCTCTGG - Intronic
1083304838 11:61756802-61756824 AGGCTGGACAGAGTGCTCCTTGG + Intronic
1083324368 11:61865969-61865991 AGGTAGGACAGAGCCACCCCCGG - Exonic
1084521823 11:69667819-69667841 AGGCGGGGCAGCGCACTCCCGGG - Intronic
1085127136 11:74009365-74009387 AGGCTGGGCACAGCTCTCCCAGG + Exonic
1086930426 11:92687084-92687106 AGGCTAGAAATAGCACCCCAGGG + Intronic
1088893886 11:114063812-114063834 TGGCTGGACAGAGCCTCCCTGGG + Exonic
1089301672 11:117502647-117502669 AGGCTGGGCAGACCACACACGGG + Intronic
1089629281 11:119774073-119774095 AGGCAGGAAAAAGCACCCCTGGG - Intergenic
1091121392 11:133060761-133060783 ACGCTGCACACAGCAGCCCCTGG + Intronic
1091284204 11:134399054-134399076 AGGCTGCAGTGAGCCCCCCCGGG - Intronic
1092039334 12:5370263-5370285 AGGCTGAACAGCACAACCCCAGG + Intergenic
1092277755 12:7075032-7075054 AGGCTTGACAGAGACCCCCGAGG + Intergenic
1094509524 12:31088024-31088046 AGGCTGGGCTGTGCACCCCTGGG + Intronic
1097263322 12:57731851-57731873 TGGCTGGATTGAGCACCCCAGGG - Exonic
1097597500 12:61652604-61652626 AGGGTTGACAGAGCAGGCCCAGG + Intergenic
1098335716 12:69402474-69402496 AGACTGGACAGAGCAGTCCTGGG - Intergenic
1099466440 12:82993982-82994004 ACGCTGCTCACAGCACCCCCTGG - Intronic
1100201497 12:92303592-92303614 AGGCAGGGCAGAGAACACCCTGG - Intergenic
1102498693 12:113336772-113336794 AGGATGAACAGAGCTTCCCCAGG - Intronic
1103798847 12:123523932-123523954 AGAGTAGACAGAGCAGCCCCAGG + Intronic
1104285560 12:127421388-127421410 GGGCTGGACAGGGCCACCCCAGG + Intergenic
1104641310 12:130469050-130469072 AGGCAGGTCAGAGCAGGCCCAGG + Intronic
1104678551 12:130732366-130732388 AGGCTGGACACCAAACCCCCTGG - Intergenic
1104769978 12:131355501-131355523 AGCCTGGACAGAGCACATCATGG + Intergenic
1104785118 12:131444150-131444172 AGGCTGGACCGAGCCCGCCCTGG - Intergenic
1104795098 12:131511738-131511760 AGGCTGGGCTGAGCAGCCCACGG + Intergenic
1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG + Intergenic
1105429915 13:20326965-20326987 GGGCTGGACACAGCACAGCCTGG + Intergenic
1105626936 13:22121753-22121775 AGACTGGCCAGAGCACCAGCCGG - Intergenic
1107888997 13:44897741-44897763 AGGCTGGAAAGAGAACCCTGGGG - Intergenic
1113354668 13:109566973-109566995 TGCTTGGACAGAGCAGCCCCAGG - Intergenic
1113835403 13:113325580-113325602 CGGGTGGTCAGAGCAGCCCCCGG + Exonic
1113910283 13:113838418-113838440 GGGCTGGGCTGTGCACCCCCGGG - Intronic
1113910315 13:113838499-113838521 GGGCTGGGCTGTGCACCCCCGGG - Intronic
1113910330 13:113838538-113838560 GGGCTGGGCTGTGCACCCCCGGG - Intronic
1113910347 13:113838580-113838602 GGGCTGGGCTGTGCACCCCCGGG - Intronic
1113910362 13:113838619-113838641 GGGCTGGGCTGTGCACCCCCGGG - Intronic
1113910378 13:113838661-113838683 GGGCTGGGCTGTGCACCCCCGGG - Intronic
1115579700 14:34745852-34745874 AGGCGGTACAGTGCACCCACCGG - Intergenic
1120879611 14:89404766-89404788 ACGCTGGACAAGGCAGCCCCAGG + Intronic
1121286444 14:92739844-92739866 AGACTGGAAAGATCTCCCCCAGG + Intronic
1121731786 14:96192555-96192577 GGGCTGGGCAGAGCCCCTCCCGG + Intergenic
1121731796 14:96192574-96192596 AGGCTGCCCAGAGCTGCCCCCGG - Intergenic
1122134023 14:99622346-99622368 TCTCTGGACAGAGCACCCCAGGG - Intergenic
1122713702 14:103680139-103680161 AGGCTGCACAGGGCCCCCTCTGG + Intronic
1122729567 14:103785898-103785920 AGGCTGGACAGGGCACTTCCTGG + Intronic
1123212652 14:106775417-106775439 AGGCTGGACCAAGCCTCCCCCGG + Intergenic
1123215204 14:106802952-106802974 AGGCTGGACCAAGCCTCCCCCGG + Intergenic
1125597085 15:40894157-40894179 AGGCTGGACAGACCACCCGAGGG + Intergenic
1126435621 15:48634465-48634487 AGGCTGGACAGAGCAGATGCTGG - Intronic
1128260944 15:66232431-66232453 AGGCTGTCCAGAGCTCCCCGGGG - Intronic
1128504564 15:68257340-68257362 TGGCTAGTCAGAGCACCCTCTGG + Intergenic
1129109890 15:73331148-73331170 AGGCAGGACAGAAGACACCCTGG - Intronic
1129235588 15:74221987-74222009 GTGCTGGACAGAGCACCCCGGGG + Intergenic
1129692694 15:77722854-77722876 GGGCTGGAGAGTGCACCCCTGGG - Intronic
1132352568 15:101148982-101149004 AGGCAGTGCAGGGCACCCCCAGG - Intergenic
1132879105 16:2153468-2153490 AGGCTGGACAGAGGGTCTCCAGG + Exonic
1133023317 16:2976456-2976478 AGTATGCACAGAGCAACCCCTGG + Intronic
1135951166 16:26915783-26915805 AGGCTGGAAAAATCACCCCATGG + Intergenic
1136273774 16:29165907-29165929 AGGCGAGACAGGGCAGCCCCAGG - Intergenic
1136613379 16:31380652-31380674 AGGCTGGAAAGAGGGCCCCTAGG + Intronic
1137505309 16:49049386-49049408 AGGCTGGGCAGCGCCCCCTCTGG + Intergenic
1138264835 16:55652855-55652877 AGACTGCACAGAGCACGCCTTGG - Intergenic
1139274455 16:65714500-65714522 AGGGTGGAAAGAGCACACCAGGG + Intergenic
1140027553 16:71304367-71304389 AGGCTGGAAAGAGCCACCTCTGG + Intergenic
1140333520 16:74081306-74081328 AGGCTGGAGAAAGAACCACCTGG + Intergenic
1141152760 16:81575572-81575594 AGGCTGGAGCCAACACCCCCAGG + Intronic
1141344788 16:83234560-83234582 AGGCTTGACTGAGCACCGCTGGG + Intronic
1141414073 16:83856546-83856568 TGGATGGCCAGAGCACACCCAGG + Intergenic
1141444654 16:84050105-84050127 AGCCTGGAGAGAGAACGCCCTGG - Intergenic
1142289124 16:89184717-89184739 AGGCTGAACAGAGGACACACGGG - Intronic
1142307953 16:89295897-89295919 CACCTGCACAGAGCACCCCCAGG - Intronic
1142405143 16:89884355-89884377 AGGCTGGACACAGAAGGCCCTGG + Intronic
1144670687 17:17131082-17131104 AGGCTGGGCAGAGCTGCCCAGGG - Intronic
1144955367 17:19016487-19016509 TGGCACAACAGAGCACCCCCTGG + Intronic
1145770077 17:27486582-27486604 AGGCTGGAGGCAGCAGCCCCGGG + Intronic
1152385332 17:79970722-79970744 AGGCTTCACTGAGGACCCCCAGG - Intronic
1152863627 17:82709744-82709766 AGGCTGGACACAGATCCCCTTGG + Intergenic
1154166144 18:12015769-12015791 AGGCTGGAGTGGGCACCTCCTGG - Intronic
1156942327 18:42783578-42783600 AGGCTGGACAGAGGACACAAGGG + Intronic
1159001004 18:62975099-62975121 AGGCTGTACACAGCAGCCCAGGG + Intronic
1160567585 18:79796950-79796972 AGGCTGAACAGATCTGCCCCTGG - Intergenic
1160730630 19:640235-640257 AGGCTGCACAGAGGAGCCTCCGG - Intronic
1160811581 19:1015179-1015201 TGGCTGGGCAGAGCGCCCCACGG + Intronic
1162162480 19:8729005-8729027 ATCCTCGAAAGAGCACCCCCAGG - Intergenic
1162969497 19:14171711-14171733 AGCCAGGAGAGAGCATCCCCAGG + Intronic
1163008229 19:14409492-14409514 AGGCTGCAGGGAGCACCACCAGG - Intronic
1163365428 19:16873437-16873459 AGCCTGGAGAGAGGACACCCAGG + Intronic
1163577972 19:18121790-18121812 AGGCAGGACACAGCACCCGCTGG - Intronic
1165139224 19:33689035-33689057 AGGATGGAAAGGGCACCCCTGGG + Intronic
1167076484 19:47252903-47252925 AGGCTGCCCAGAGCACCCTGGGG - Intergenic
1167935587 19:52904261-52904283 AGGCTGGCCAGAGTCCCCCGCGG + Intergenic
925182997 2:1829166-1829188 GGACTGGGCAGAGCACTCCCTGG + Intronic
925521666 2:4753364-4753386 AGGGTGGACAGAGCCTCACCTGG + Intergenic
926196842 2:10769120-10769142 AGGCTGCACGGAGGGCCCCCAGG + Intronic
927438246 2:23088834-23088856 AGACTGGACACAGCAGCCCTGGG + Intergenic
927650803 2:24912517-24912539 AGGCTGGGCAGACCAAGCCCAGG + Intronic
927843069 2:26457470-26457492 AGGCAGGACAGGCGACCCCCTGG + Exonic
927846760 2:26476266-26476288 AGGCTGGACAGTGCAGGCCAAGG - Exonic
928410158 2:31048484-31048506 AGGCTGGAAAGACCTCTCCCTGG + Intronic
928749874 2:34458911-34458933 AGGCTGCACAGAGCAGCAACAGG - Intergenic
929552394 2:42902944-42902966 AGGCAGGAATCAGCACCCCCAGG - Intergenic
930111756 2:47684865-47684887 AGGCAGGGCAGAGCACCCAGTGG - Intergenic
932476820 2:72011559-72011581 AGTGTGGAGAGAGCACACCCTGG - Intergenic
935561407 2:104563666-104563688 AGGCTGGTCAGAGGTTCCCCAGG + Intergenic
936383007 2:112004351-112004373 AGGCCGGCCAGAACAACCCCTGG - Intronic
937052764 2:118905828-118905850 GGGCTGGGGAGAGCACCCCGGGG + Intergenic
937223818 2:120356940-120356962 GGGCTGGGCAGAGCAGACCCCGG - Intergenic
937289995 2:120776392-120776414 AGGCTAGACTCAGCACACCCTGG - Intronic
938681999 2:133701543-133701565 AGGCAGCACTGAGCACCCGCAGG - Intergenic
940000360 2:148961327-148961349 AGGCTGGCCAGAGGACACCATGG - Intronic
944021810 2:195114507-195114529 AGGCTGCACAGAGCAGCAGCAGG - Intergenic
946323706 2:218970997-218971019 AAGCTGGTTAGAGCACCCCAGGG - Intergenic
947618503 2:231574027-231574049 AGCTGGGACAGAGCACCCCTTGG + Intergenic
948594695 2:239072455-239072477 AGGCTGGGCTGAGCAGCTCCAGG - Intronic
948972764 2:241441946-241441968 GGGCTGGACCGAGCAGACCCTGG - Intronic
949009579 2:241670892-241670914 AGGCGGGACAAAGCTCCCCACGG - Intronic
949035496 2:241814151-241814173 AGGCTGGCCAGAGAGCCCCCGGG - Intronic
1169399207 20:5265488-5265510 AGACTGCACAGAGCATCCCTTGG - Intergenic
1169881211 20:10349427-10349449 ATCCTCGAAAGAGCACCCCCAGG - Intergenic
1174130060 20:48337860-48337882 TTGCTGCACAGAGCACCCCTAGG - Intergenic
1175889448 20:62309861-62309883 AGGCTGGGCTGAGGACCACCTGG - Intronic
1176103223 20:63373935-63373957 AGGCTGGACCGAGCCCACCCTGG - Intronic
1178933221 21:36837790-36837812 GGGCTGGACCGAGCCCACCCAGG - Intronic
1179566146 21:42250407-42250429 AGGATGCCCAGAGCACCCACGGG - Intronic
1179618201 21:42595323-42595345 AGGCTGGGCTGAGCACGTCCAGG + Intergenic
1180098684 21:45574297-45574319 AGGGTGGCCGGAGCACCCACTGG - Intergenic
1180157591 21:45985691-45985713 TGGCTGGACAGGGCAGCCTCGGG - Intronic
1181388076 22:22558932-22558954 GGGCTGAAGAGACCACCCCCCGG + Intronic
1181554763 22:23662550-23662572 AGGCTGGACAGGCCACTCCTGGG - Intergenic
1182038334 22:27216706-27216728 AGGCTGCACAGAGCACACCTGGG - Intergenic
1182397483 22:30046695-30046717 AGGCTGGCCAGTGCATCCTCGGG - Intergenic
1182848252 22:33449364-33449386 GGGCTGTGCAGAGCTCCCCCAGG + Intronic
1183282251 22:36938047-36938069 GGGCTGGCCAGTGGACCCCCTGG + Exonic
950265586 3:11570462-11570484 TGGCTGGACCGTGCACTCCCGGG + Intronic
952828049 3:37540227-37540249 AGGCTGGTCAGGGGACCCCGAGG + Intronic
952885407 3:38008641-38008663 AGGCAGGACAGAGCAGTCACAGG + Intronic
952906209 3:38140645-38140667 AGGCTGGACAGTGCACAGCTAGG - Intronic
952964613 3:38613492-38613514 AGGGGGCACAGAGCACCCCACGG - Intronic
953184940 3:40629205-40629227 AGGCTGCACAGAGCAGCCCTGGG - Intergenic
953923417 3:46967541-46967563 AGGCTGGGAAGACCACCACCTGG - Intronic
954677825 3:52325385-52325407 AGGCTGCCCAGAGCCCACCCAGG + Intronic
955175924 3:56612848-56612870 AGGCTGGGCAGACCTGCCCCCGG + Intronic
955328015 3:58024485-58024507 AGTCTGGAGAGACCACCCCCAGG - Intronic
960940100 3:122927889-122927911 TGGCTGCATAGAGCTCCCCCTGG + Exonic
961741201 3:129034100-129034122 AGGCTGGACAGAGCGGGCTCTGG + Intronic
962710318 3:138080754-138080776 AGGCAGGACAGAGCAGACACTGG + Intronic
963047442 3:141112970-141112992 TGCCTGGACAGAGCCCCTCCAGG + Intronic
963115982 3:141729442-141729464 AGGCTCCACACAGCACTCCCTGG - Intergenic
963787353 3:149548365-149548387 AGGCTGCCCAGAGCACCTCCTGG + Intronic
963805105 3:149714582-149714604 AGGCTGTCCTCAGCACCCCCTGG - Intronic
968510386 4:993015-993037 AGGCTGGGCACAGCACCCCTGGG + Intronic
968663555 4:1809045-1809067 AGCCAGGGCAGTGCACCCCCAGG - Intergenic
968873856 4:3255007-3255029 GGGGTGGAGAGACCACCCCCAGG - Intronic
969100244 4:4763181-4763203 AGGCTGCACAGAGGAATCCCAGG + Intergenic
970967952 4:21949111-21949133 GGGCTGGGCAGGACACCCCCGGG + Intergenic
971218965 4:24687538-24687560 AGGCGGGAAAGGGCGCCCCCTGG + Intergenic
972276527 4:37563317-37563339 AAGCTGGAAAGAGCTCTCCCGGG - Intronic
978072656 4:104491708-104491730 AGGCTGTTCAGAGCCCCCTCGGG + Exonic
979929893 4:126617324-126617346 GGGCTGGACAGAGACCCACCGGG + Intergenic
982235758 4:153249634-153249656 AGGCTGAACAGAGGCCCCCAGGG - Intronic
983270848 4:165560040-165560062 AGGCTGGAAACATCCCCCCCAGG + Intergenic
984717549 4:182939807-182939829 AGACTGGAACGAGGACCCCCTGG - Intergenic
985648319 5:1095524-1095546 AGGATGGGCCGAGCACCCCTAGG - Intronic
985708638 5:1415741-1415763 AGGGAGGACAGAGACCCCCCGGG + Intronic
985784448 5:1886648-1886670 AGGCTGGACGGAGCGCCGTCCGG + Intronic
986273357 5:6253224-6253246 AGGTGGGACAGGGCTCCCCCAGG + Intergenic
990330361 5:54719633-54719655 AGTCAGCACAGAGCACCCGCTGG + Intergenic
990448950 5:55917808-55917830 AGACTGGACAGAGCTGCGCCCGG - Intronic
1000006654 5:157191267-157191289 ATTCTGGACAAAGTACCCCCAGG - Intronic
1001571541 5:172733501-172733523 AGGCTGGACACAGAACCACAAGG - Intergenic
1001758113 5:174186283-174186305 AGGCTGCCCCGAGGACCCCCCGG + Intronic
1002472883 5:179447713-179447735 AGGCTAAACAGAAGACCCCCAGG + Intergenic
1002481339 5:179502949-179502971 AGGCTAAACAGAAGACCCCCAGG - Intergenic
1002579208 5:180197364-180197386 AGGCTGGACAGAGAAGGCCTGGG + Intronic
1002582391 5:180216589-180216611 AGGCTGAACAGAGCCCCTGCAGG + Intergenic
1002761713 6:207655-207677 AGGCTGGACAGATCACGCAGTGG + Intergenic
1003500885 6:6701851-6701873 AAGCTGGGCAGAGCCCACCCAGG + Intergenic
1004180437 6:13376447-13376469 AGGATTCACAGTGCACCCCCTGG + Intronic
1004467732 6:15901552-15901574 GGGCAGGAGAGGGCACCCCCAGG - Intergenic
1006093017 6:31639346-31639368 AGGCTTGACAGTGCCACCCCGGG - Intronic
1007414569 6:41684182-41684204 AGGCAGGCCTGAGCACCCCCAGG + Exonic
1013013858 6:106143753-106143775 AGGCAGTTCAGAGCAGCCCCTGG - Intergenic
1013512643 6:110858717-110858739 AGGCTGGCCAGTGCACCATCGGG + Intronic
1015024606 6:128519347-128519369 CGGCTTGACCGAGAACCCCCAGG + Intronic
1015911024 6:138167867-138167889 CGGCTGGACAGAACACACCAAGG - Intronic
1016289232 6:142509892-142509914 GGGCTGGACAGAGCAAGTCCAGG - Intergenic
1017758187 6:157547440-157547462 ATCCTAGACAGAGCATCCCCTGG + Intronic
1019664728 7:2246125-2246147 GGGCTGGGCAGAGAACCCCCGGG - Intronic
1021781411 7:24110192-24110214 AGGCTGGGAAGAGCTCCCCCTGG - Intergenic
1023673261 7:42602359-42602381 AGGCTGGACTGAGCAGCACTGGG - Intergenic
1023785591 7:43705071-43705093 AGGCTCAACAGAGCACTCCTGGG + Intronic
1024083689 7:45876482-45876504 AAGCTGGCCAGGCCACCCCCAGG + Intergenic
1025006829 7:55362149-55362171 AGGCAGCACAGAGCACCCCATGG + Intergenic
1026382204 7:69811087-69811109 ACTCTGGCCAGAGAACCCCCAGG - Intronic
1030426720 7:109387658-109387680 AGGCTGGACAACACATCCCCAGG - Intergenic
1034453105 7:151148433-151148455 AGTCTGGGAAGAGCACACCCAGG + Intergenic
1034456786 7:151174906-151174928 TCGCTGGACAGAGTTCCCCCAGG - Intergenic
1035475329 7:159139828-159139850 AGCCTGGACAAAGCCCCCTCAGG + Intronic
1036044474 8:5123839-5123861 AGGCAGGAGAGGGAACCCCCAGG - Intergenic
1036492979 8:9244905-9244927 AGCCAGGACAAAGCAGCCCCAGG + Intergenic
1036761198 8:11509581-11509603 AGACCCGGCAGAGCACCCCCAGG - Intronic
1037260366 8:17001564-17001586 GGGCTGGCCAGAGCAGCCGCGGG - Intronic
1039708715 8:40033819-40033841 ATGCAGGACGGAGCAGCCCCTGG + Intergenic
1040543425 8:48379572-48379594 AGGCCAGACAGAGCACCTACCGG - Intergenic
1041477019 8:58278137-58278159 TGGCAGGACAGAGCACCTTCTGG - Intergenic
1041942610 8:63405316-63405338 AAGCAGGACAGAGCACCCCCAGG - Intergenic
1048330162 8:133465742-133465764 AGGCTCCACACTGCACCCCCTGG - Intronic
1049316480 8:141971553-141971575 CGGCTGGACAGATCTTCCCCTGG + Intergenic
1049556816 8:143286652-143286674 AAGGTGGACAGAGCACCACGGGG - Intergenic
1049680275 8:143915083-143915105 AGGGTGGACATTGCAGCCCCAGG - Intergenic
1049748997 8:144274753-144274775 AGGCCTGGCAAAGCACCCCCAGG + Intronic
1051988645 9:23123230-23123252 ATGCTGGACCTTGCACCCCCTGG - Intergenic
1052192890 9:25678517-25678539 AGCCTGGAGAGAGCAGGCCCAGG - Intergenic
1052916761 9:33929064-33929086 AGGCCGGAGAGAGCCCCACCAGG + Intronic
1056039753 9:82651603-82651625 AGGCTGGCCTTAGCAGCCCCTGG - Intergenic
1056548867 9:87635236-87635258 AGGCTGGACAGTGGAGTCCCTGG + Intronic
1056769234 9:89464835-89464857 AGGGTGCGGAGAGCACCCCCAGG + Intronic
1057180763 9:93028850-93028872 AGGCTGGACTGGGCAGCCCCAGG + Intronic
1057272309 9:93658045-93658067 AGGCTGGACCTGGCATCCCCCGG + Intronic
1057821101 9:98331718-98331740 AGGCTGTGCTGAGCACCTCCTGG + Intronic
1059249931 9:112879460-112879482 AGGCTGCACACAGCAGTCCCAGG - Exonic
1059452199 9:114377378-114377400 AGGCTGGAGAGAGCTCCTCAAGG - Exonic
1060551237 9:124486356-124486378 AGGCAGGGCAGTGCATCCCCAGG + Intronic
1061595978 9:131629294-131629316 AGGCGGGACAGAGCACACACAGG + Intronic
1061855107 9:133437745-133437767 TGTCTGCACAGAGCATCCCCTGG - Exonic
1061920413 9:133779468-133779490 AGGCTGTACTGAGCACTGCCTGG + Intronic
1062030566 9:134360133-134360155 AGGCAGGACAGAGCAATCGCGGG - Intronic
1062277529 9:135737821-135737843 AAGCTGGGCAGTGCCCCCCCAGG - Intronic
1187461496 X:19491354-19491376 ACAGTGAACAGAGCACCCCCAGG + Intronic
1187900626 X:24024856-24024878 AGGCTGGACAGGACCCCCCGAGG - Exonic
1190165769 X:48071721-48071743 AGGCTGGACAGAGCACCCCCCGG + Intergenic
1191742365 X:64449306-64449328 AGGCTGCACAGAGCAGCCATGGG + Intergenic
1193850466 X:86531407-86531429 AGGCTGCACAGAGCAGCAGCAGG - Intronic
1196223595 X:113139531-113139553 AGGCTGCACAGAGCAACACTGGG + Intergenic
1198693274 X:139307508-139307530 AGGCTGCACAGAGCAGCATCTGG - Intergenic
1199170957 X:144733820-144733842 AGGCTGCACAGAGCAGCAGCAGG + Intergenic
1200344539 X:155435552-155435574 AGGCTGGACAGAGCCCCCTGTGG + Intergenic
1201894963 Y:18983365-18983387 GGGCTGGGCTGAGCTCCCCCTGG + Intergenic
1202199445 Y:22331257-22331279 AGGCTGGAAAGAACACCCGTGGG + Intronic
1202256840 Y:22929937-22929959 AGGCAGGACAGTGAACCACCTGG - Intergenic
1202409832 Y:24563690-24563712 AGGCAGGACAGTGAACCACCTGG - Intergenic
1202460951 Y:25106387-25106409 AGGCAGGACAGTGAACCACCTGG + Intergenic