ID: 1190170963

View in Genome Browser
Species Human (GRCh38)
Location X:48111273-48111295
Sequence TATTACGCATGAAAAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190170963_1190170969 30 Left 1190170963 X:48111273-48111295 CCTCTCACTTTTCATGCGTAATA 0: 1
1: 1
2: 2
3: 18
4: 103
Right 1190170969 X:48111326-48111348 CTGATAATGACCGTAACCGTGGG 0: 1
1: 1
2: 3
3: 6
4: 17
1190170963_1190170968 29 Left 1190170963 X:48111273-48111295 CCTCTCACTTTTCATGCGTAATA 0: 1
1: 1
2: 2
3: 18
4: 103
Right 1190170968 X:48111325-48111347 TCTGATAATGACCGTAACCGTGG 0: 1
1: 1
2: 3
3: 3
4: 19
1190170963_1190170966 0 Left 1190170963 X:48111273-48111295 CCTCTCACTTTTCATGCGTAATA 0: 1
1: 1
2: 2
3: 18
4: 103
Right 1190170966 X:48111296-48111318 AACGGGCCACAGACTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190170963 Original CRISPR TATTACGCATGAAAAGTGAG AGG (reversed) Intergenic
902735249 1:18396404-18396426 TATGACTCATGATAAGTGACTGG - Intergenic
906888679 1:49682503-49682525 GAATAAGCATCAAAAGTGAGAGG - Intronic
912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG + Intronic
917949711 1:180018507-180018529 TATTACAAATGCAAAGTGTGAGG - Intronic
1064067746 10:12197228-12197250 TATTAAGAAAGAAAATTGAGTGG + Intronic
1064599426 10:16977926-16977948 TATTACACATGAAAAATTATAGG + Intronic
1069516962 10:69085424-69085446 AAGGACGCATAAAAAGTGAGTGG + Intergenic
1071400857 10:85269264-85269286 TTTTACAAATTAAAAGTGAGTGG - Intergenic
1071428595 10:85584181-85584203 TAAAACTCATAAAAAGTGAGGGG - Intergenic
1075478373 10:122756513-122756535 AATCACCCATGAAATGTGAGTGG + Intergenic
1078273015 11:9814198-9814220 TCTTTGGCATGAAAAGTTAGAGG - Intronic
1078475940 11:11630153-11630175 TATTATGGTTGAAGAGTGAGTGG - Intergenic
1078735611 11:14017597-14017619 TTTTACAGATGAAAAGTTAGAGG + Intronic
1079623547 11:22585727-22585749 TATTCCTAATGAAAAGTTAGAGG + Intergenic
1079939239 11:26657618-26657640 TTATACGGATGAAAAGGGAGTGG - Intronic
1080201066 11:29670777-29670799 AATTACTCATGAAAATTGTGGGG - Intergenic
1084850380 11:71934686-71934708 TTTTAGGCATGTAAAATGAGTGG + Intronic
1086816219 11:91374820-91374842 AATTAAGCATGGAAAGTGTGTGG + Intergenic
1089753700 11:120670265-120670287 TTTTGAGAATGAAAAGTGAGGGG - Intronic
1102570670 12:113825304-113825326 TGTTAATCATGAAAAGGGAGAGG + Intronic
1105661284 13:22498304-22498326 AATTTCCCATGAAAAGTGTGTGG - Intergenic
1109703190 13:66053826-66053848 TCTTAGGCCTGAAAATTGAGTGG - Intergenic
1111026306 13:82530826-82530848 TATTTCCCTTTAAAAGTGAGAGG + Intergenic
1118121416 14:62848386-62848408 TAGTACGCATGAAAACAGAAGGG - Intronic
1121809898 14:96875757-96875779 TATAAAGCATGAAAAGTTAGAGG + Intronic
1126100863 15:45117454-45117476 TTTTACAGATGAAAAGTGGGGGG + Exonic
1133974523 16:10591153-10591175 TTTTAAGCATGGAAAGTGGGTGG + Intergenic
1134867987 16:17626058-17626080 CACTAAGCCTGAAAAGTGAGTGG + Intergenic
1138850326 16:60621470-60621492 TATGAGACAAGAAAAGTGAGTGG - Intergenic
1146066483 17:29639717-29639739 TATCACGCATCTCAAGTGAGTGG + Intronic
1146643819 17:34563114-34563136 CTTTACGCATGAAAGGAGAGAGG + Intergenic
1148192932 17:45692393-45692415 TATTATGGATGAAAAGTTTGAGG - Intergenic
1149007744 17:51822972-51822994 TATTAAGCAGCAAAAGTGGGTGG - Intronic
1153623902 18:7005233-7005255 GATTATTCATGAAAAGTGATGGG - Intronic
1153874473 18:9355722-9355744 TATTTCTCCTGAAAAGTAAGAGG + Intronic
1155088599 18:22483408-22483430 TGTTACGCATGGAAACTGACTGG + Intergenic
1155840493 18:30636653-30636675 GATGACGCAGGAAAAGTGATTGG - Intergenic
1156104737 18:33646612-33646634 TATTTCTCCTGCAAAGTGAGAGG + Intronic
1156723808 18:40103102-40103124 TATTATGCAAGAAAAATGAAAGG - Intergenic
1157631197 18:49097848-49097870 TATTAAGCTTCAAAAGTGATAGG - Intronic
1159633519 18:70778297-70778319 TATTACGCATGACAAAAGATAGG - Intergenic
932825686 2:74937461-74937483 TATAATGCATGAAACGTGATTGG + Intergenic
933472625 2:82746152-82746174 TATTACTGATGAGAAGTAAGTGG + Intergenic
937472355 2:122185165-122185187 TATTGCACATGCAAAGTGGGAGG - Intergenic
939010210 2:136837536-136837558 TATTAAGCAGGAATAGAGAGTGG - Intronic
939462416 2:142513867-142513889 TATGAAGCAAGAAAAGTCAGTGG + Intergenic
941612253 2:167676198-167676220 AATTACTCATAAAAAGAGAGGGG - Intergenic
942608379 2:177715605-177715627 TATTATGCCTGGAAAGTAAGAGG - Intronic
942731791 2:179068166-179068188 TATTACGAATGCAAAGTGTCTGG - Intergenic
1170037282 20:12003047-12003069 TATTACCCAAGAAAAGGGGGTGG - Intergenic
1171296822 20:24024316-24024338 AATTAGCCATGAAAAGAGAGGGG + Intergenic
1173841797 20:46162240-46162262 AATTACTCATGAAGAGAGAGAGG + Intergenic
1176702581 21:10073594-10073616 TAAGACGCAAGAAAAATGAGGGG - Intergenic
1176956436 21:15109688-15109710 TATAAAGCTTGAAAAGTGGGGGG + Intergenic
952238041 3:31500595-31500617 CATTGTGCATGAAAAGAGAGGGG - Intergenic
953542218 3:43831315-43831337 TATTACTGATGAAAATTGAGTGG - Intergenic
955314730 3:57927236-57927258 TAATAGGTATGAAAAGAGAGGGG + Intronic
958791460 3:98656180-98656202 TACTAGGAATGAAAAGAGAGTGG - Intergenic
961549543 3:127661150-127661172 TTCTACGCAGGTAAAGTGAGGGG + Exonic
962969255 3:140383747-140383769 TATTTTGCATGAAAAGTAAGAGG + Intronic
965048452 3:163611821-163611843 TACTACGAATGAAAAGTGAAAGG - Intergenic
965292586 3:166902855-166902877 GATTAAGCTTGAAAATTGAGGGG - Intergenic
966141053 3:176756396-176756418 TTTTGCCCATGAAATGTGAGTGG - Intergenic
967130646 3:186467558-186467580 TAATCCACATGAAAAGAGAGGGG - Intergenic
976054562 4:81048389-81048411 TATTACCCTTTATAAGTGAGAGG - Intronic
977018467 4:91726620-91726642 TATTTCCCAAGAAAAGTGAAAGG - Intergenic
979795144 4:124837155-124837177 TTTTACGCCTGAATAGTGAATGG + Intergenic
984405289 4:179321124-179321146 TATTATGCATGACAAGTGCTTGG - Intergenic
989034864 5:37160035-37160057 TATTATGCATAAAAGGTGATAGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
996303019 5:122010509-122010531 TTTTCTGCATGAAAAGTGAGAGG - Intronic
997386585 5:133478144-133478166 TATTACTAATGAAAAATGTGTGG + Intronic
998162081 5:139819075-139819097 TATTAAGCATGCAAAGAGACAGG - Intronic
999897639 5:156052338-156052360 TATTACAGATGAAAGGGGAGAGG + Intronic
1000845698 5:166277456-166277478 TGTTACTCATGAAAAATAAGGGG - Intergenic
1000885837 5:166746348-166746370 TATAATGCATGTAAAGTGATTGG - Intergenic
1004000890 6:11596047-11596069 TCTTACCCATGCACAGTGAGAGG - Intergenic
1009944542 6:70327988-70328010 TATTAAGAATCAAAAGTGAGGGG + Intergenic
1014158380 6:118137964-118137986 TATTAGGCAGGGAAACTGAGGGG - Intronic
1014492427 6:122078823-122078845 TATTATGCATGATAAATGGGAGG + Intergenic
1015217650 6:130768293-130768315 TGATACTCATGAAAAGAGAGAGG - Intergenic
1020584355 7:10047432-10047454 TATTTCACATGAAAAATGATTGG - Intergenic
1021279302 7:18697568-18697590 TATTACAGTTGAAAAGGGAGTGG - Intronic
1022337600 7:29436416-29436438 TATTACGCTTGAATATTGATGGG + Intronic
1022744387 7:33155245-33155267 TATTTCTCATGAAAAATAAGAGG - Intronic
1022969795 7:35506435-35506457 TATTAGGCATAAAAACTGATGGG + Intergenic
1023271464 7:38467771-38467793 GATTACATATCAAAAGTGAGTGG + Intronic
1023350612 7:39316920-39316942 TCTTTCACTTGAAAAGTGAGGGG + Intronic
1026310983 7:69184081-69184103 TATTTCCAATGAAATGTGAGTGG - Intergenic
1028983055 7:96988691-96988713 TAGTATGCATGAAAAGGGAAGGG + Intergenic
1029690444 7:102177791-102177813 TATTAGTAATGAAAAGTGTGCGG - Intronic
1037199470 8:16234499-16234521 TGTTATGTATGAAAACTGAGAGG - Intronic
1042716531 8:71779163-71779185 TATTAGCGATGACAAGTGAGAGG - Intergenic
1042775067 8:72421075-72421097 TATTACTCATGAAAGATGTGTGG - Intergenic
1043626501 8:82267260-82267282 TTTTACAGATGAAAAGTGTGAGG + Intergenic
1045404687 8:101853913-101853935 TCTTACACATCAAAAGTCAGGGG + Intronic
1052016075 9:23469495-23469517 AATTAGGCAAGAAAAGTTAGCGG + Intergenic
1053639781 9:40060389-40060411 TAAGACGCAAGAAAAATGAGAGG - Intergenic
1053766352 9:41405095-41405117 TAAGACGCAAGAAAAATGAGAGG + Intergenic
1054320530 9:63656694-63656716 TAAGACGCAAGAAAAATGAGAGG - Intergenic
1054544968 9:66316251-66316273 TAAGACGCAAGAAAAATGAGAGG + Intergenic
1059163601 9:112058434-112058456 TATTACGAATCACAAGTGAATGG - Exonic
1062100875 9:134728010-134728032 TATTACGGATGAGAAATGAGAGG - Intronic
1202787599 9_KI270719v1_random:43702-43724 TAAGACGCAAGAAAAATGAGGGG - Intergenic
1186448371 X:9651855-9651877 TATTAAGAGTGCAAAGTGAGAGG + Intronic
1190170963 X:48111273-48111295 TATTACGCATGAAAAGTGAGAGG - Intergenic
1190177089 X:48159284-48159306 TATTACGCATGAAAGGTGAGAGG - Intergenic
1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG + Exonic
1190188826 X:48258549-48258571 TATTACACATGAAAGGTGGGAGG - Exonic
1190190913 X:48276768-48276790 TATTACACATGAAAGGTGGGAGG + Intronic
1190194230 X:48303664-48303686 TATTACACATGAAAGGTGGGAGG + Intergenic
1190200104 X:48354059-48354081 TATTACGCATGAAAGATGGGAGG + Exonic
1190203799 X:48385365-48385387 TACTACGCATGAAAGGTGGGAGG - Exonic
1190206737 X:48410038-48410060 TACTACGCATGAAAGGTGGGAGG + Exonic
1190655699 X:52610597-52610619 TATTATGCATGAAAGGTGAGAGG + Intergenic
1190657715 X:52626305-52626327 TATTACACATGAAAGGTGGGAGG - Intergenic
1190660744 X:52652312-52652334 TATTATGCATGAAAGGTGGGAGG + Exonic
1190666901 X:52704557-52704579 TATTACACATGAAAGGTGGGAGG + Exonic
1190672517 X:52753851-52753873 TATTACACATGAAAGGTGGGAGG - Exonic
1194177949 X:90674952-90674974 TAGTAGGTATGAAGAGTGAGTGG + Intergenic
1194242044 X:91462088-91462110 TAATACTAATGAAAAGAGAGTGG + Intergenic
1195483737 X:105378272-105378294 TATTTTACATGAAAACTGAGAGG + Intronic
1196534537 X:116827362-116827384 CTTTATACATGAAAAGTGAGAGG + Intergenic
1197890909 X:131269383-131269405 TATTACACATGAAAAAACAGAGG - Intergenic
1200524616 Y:4257110-4257132 TAGTAGGTATGAAGAGTGAGCGG + Intergenic