ID: 1190171003

View in Genome Browser
Species Human (GRCh38)
Location X:48111627-48111649
Sequence CTGTAAATGGAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190170999_1190171003 -2 Left 1190170999 X:48111606-48111628 CCATCAAATTGAGGAGACTGGCT No data
Right 1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190171003 Original CRISPR CTGTAAATGGAGAAGGAGCA GGG Intergenic
No off target data available for this crispr