ID: 1190173328

View in Genome Browser
Species Human (GRCh38)
Location X:48128982-48129004
Sequence GTGGATGTGGGCCAAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 2, 1: 0, 2: 4, 3: 19, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190173328 Original CRISPR GTGGATGTGGGCCAAAGTGA GGG Intergenic
900919040 1:5659151-5659173 CTGGAGATGGGCCCAAGTGAAGG - Intergenic
903857673 1:26346290-26346312 GAGGCTGTGGACCAGAGTGATGG - Exonic
906200881 1:43959523-43959545 GTAGATGTGGTCTTAAGTGAAGG + Intronic
906491729 1:46273819-46273841 GTGGATGTGGGCCAAGATCTGGG + Intronic
906790552 1:48655200-48655222 GTGGGTGTGGGGCAAGGAGAGGG + Intronic
906885296 1:49638908-49638930 GTGGTTAGGGACCAAAGTGAAGG + Intronic
909275868 1:73686138-73686160 GTGGATGGGGGGCAAAGGGATGG - Intergenic
910171188 1:84378669-84378691 GTGAATGTGGGACTATGTGATGG - Intronic
911219306 1:95230409-95230431 GTGGATTTGGGCCATATGGATGG + Intronic
913572270 1:120132246-120132268 GTGGCTGTGGGCCGAAGTGCAGG - Intergenic
913584548 1:120261112-120261134 GGGGCTGTGGGGCAAGGTGAGGG + Intergenic
914293192 1:146293890-146293912 GTGGCTGTGGGCCAAAGTGCAGG - Intergenic
914554236 1:148744673-148744695 GTGGCTGTGGGCCAAAGTGCAGG - Intergenic
914566545 1:148872968-148872990 GGGGCTGTGGGGCAAGGTGAGGG + Intronic
914606274 1:149257272-149257294 GGGGCTGTGGGGCAAGGTGAGGG - Intergenic
916731383 1:167570148-167570170 GGGGATGGGGGGCAAGGTGAGGG - Intergenic
916999618 1:170342279-170342301 CTGGATGTGGCCTACAGTGATGG + Intergenic
919350058 1:196439889-196439911 GTGGGTGTGGGTCAAGGGGAGGG + Intronic
919454659 1:197807015-197807037 GAGGATGTGGACAAAAATGAAGG + Intergenic
921137184 1:212272287-212272309 GTGGCTGTGGGCCAAAGATCAGG - Intergenic
921482539 1:215679399-215679421 GTTGATGAGGGCCTAAGAGATGG + Intronic
922731190 1:227949476-227949498 GTGCATGTGGGGCAAAGCAAGGG + Intergenic
923945433 1:238881303-238881325 GTGGGTGGGGGACAAAGGGAGGG + Intergenic
1062910677 10:1209706-1209728 GTGGGTGTGGGCCAAGCTGTAGG - Intronic
1064954483 10:20892645-20892667 GTGGGTGAGGGCAAAAGAGAAGG - Intronic
1069594039 10:69659091-69659113 GTGGATGGCAGACAAAGTGATGG + Intergenic
1070253589 10:74794939-74794961 GGGGATGTTGGCCACAGAGAGGG + Intergenic
1070554437 10:77516936-77516958 GTGGATGAGGGAGGAAGTGAGGG + Intronic
1072264334 10:93713126-93713148 GTGGGGGTGGGCCAAAGTGCAGG - Intergenic
1072455083 10:95568422-95568444 GTGGAGGAGGGCAGAAGTGAAGG + Intergenic
1074218364 10:111410258-111410280 GTGAATGTGTGACAAAGTGCTGG + Intergenic
1074394461 10:113086167-113086189 GAGGATGTGGGAAAAATTGAAGG - Intronic
1075677349 10:124304538-124304560 GGGGATGTGAACCAACGTGAAGG - Intergenic
1076145405 10:128115263-128115285 GTGAATCTGGGTAAAAGTGAAGG - Exonic
1076861565 10:133140383-133140405 GTGGATGTAGGCCAGGGTGGCGG - Intergenic
1077832571 11:5890528-5890550 GTTTATGTGGGCCAATGTGCTGG - Intronic
1078454711 11:11465940-11465962 GTGGATGTGAGCCAAAGTCAGGG + Intronic
1079077024 11:17390324-17390346 GTGGCTGTGGGCCACAGTGGGGG + Intergenic
1079160799 11:17992001-17992023 GGCAATGTGGGCCAAAGAGAAGG + Intronic
1079511214 11:21212653-21212675 ATGGATTTGGGAGAAAGTGAGGG - Intronic
1080040475 11:27754471-27754493 GTGGGTGTGGGGCAAATTGGTGG - Intergenic
1080279072 11:30535760-30535782 GTGGCTCTGGGGCAAAGGGATGG - Intronic
1080303029 11:30805916-30805938 GGGGATGGGGGGCAAAGGGAGGG - Intergenic
1080935574 11:36859302-36859324 TGGGATGTGAGCAAAAGTGATGG - Intergenic
1081118697 11:39236761-39236783 GGGGATGTGGGCCAAGGGGAGGG + Intergenic
1082662317 11:55926883-55926905 GTGGATGTGAACTAAAGAGAAGG - Intergenic
1083036793 11:59645371-59645393 GTGGATGGGGGGGGAAGTGAGGG - Intronic
1083932461 11:65853445-65853467 GAGGATGTGGGGCAGAGTGAGGG - Exonic
1084347556 11:68565398-68565420 TTGGATGTGGACCATAGTGTTGG + Intronic
1087283090 11:96234110-96234132 CTGTATGTGTGCCCAAGTGAGGG + Intronic
1088019407 11:105101291-105101313 GTTTATGTGAGCAAAAGTGAGGG - Intronic
1088837166 11:113587451-113587473 GTGCATGTGGGCCTCAGAGATGG - Intergenic
1089399280 11:118155144-118155166 GAGGAGGTGAGCCAAAGGGAAGG + Intergenic
1090308319 11:125710956-125710978 GGGGGTGTGGGCCAAGGGGAGGG + Intergenic
1091058219 11:132438680-132438702 GTGGAGGTGGGCCAGTGTGCAGG + Intronic
1091325592 11:134684708-134684730 GTGGATATGGGCCAAGGAGGCGG - Intergenic
1093996292 12:25646339-25646361 GCAGATGAGGGCCAGAGTGATGG - Intronic
1095494258 12:42768233-42768255 GTGGCTGTGAACCCAAGTGAAGG + Intergenic
1095877607 12:47098942-47098964 GTGGATGTGTGCAAAATTGTTGG + Intronic
1098924776 12:76337357-76337379 GTGGCTGGGGCCCAACGTGAAGG + Intergenic
1099354108 12:81611719-81611741 GGGGAGGCGGGCCCAAGTGATGG + Intronic
1099372104 12:81847137-81847159 GGGGATGGGGGCCAAACAGAGGG + Intergenic
1101538456 12:105642285-105642307 ATGGATGGGGGCCATAATGAAGG + Intergenic
1102198356 12:111040425-111040447 GTGTTTGTGGGACAAAGAGAAGG - Intronic
1102589348 12:113945779-113945801 TGGGATCTGGGCCAAACTGAAGG - Intronic
1102709541 12:114914085-114914107 CTGGATGGGGGCCAGAGTCAGGG + Intergenic
1103075759 12:117981267-117981289 GTGGGAGGGAGCCAAAGTGAGGG - Intergenic
1103773097 12:123344037-123344059 GTGGATGTATGCCATTGTGAGGG - Intronic
1105016320 12:132788120-132788142 GGGGAGGTGGGCCAAGGGGAGGG - Intronic
1105689373 13:22820700-22820722 GTGGGTGGGGGCCAAGGAGAGGG + Intergenic
1113086707 13:106576436-106576458 GTTGATGTGGGATAAAGTGTGGG + Intergenic
1114613436 14:24056358-24056380 GGGGTTGTGGGACAGAGTGAGGG - Exonic
1114912766 14:27220852-27220874 GTGGGAGTGGGCCCAAGTGTAGG + Intergenic
1115359297 14:32483918-32483940 GGGGATGGGGGGCAAGGTGAGGG - Intronic
1115904094 14:38187714-38187736 CTGGAGAGGGGCCAAAGTGAGGG + Intergenic
1117062784 14:51980341-51980363 TTGGATGTGGGGAAAAGTCAGGG + Intergenic
1118294786 14:64558999-64559021 GTGGATCTGGGACTAAGGGAAGG + Intronic
1119586008 14:75835903-75835925 GAGGATGTGGAGCATAGTGAAGG + Intronic
1120125654 14:80739416-80739438 GTGGATGAGGTCAAAAGTAAAGG - Intronic
1121280431 14:92693521-92693543 GTGGACGTGGGCCCAAGACAGGG - Intergenic
1122134672 14:99625987-99626009 GTGGATGTGGGCCAGACACAGGG - Intergenic
1124632506 15:31345612-31345634 GGGGATGGGGGCCAAAGGAACGG - Intronic
1126514371 15:49519032-49519054 GGAGAAGTTGGCCAAAGTGAAGG + Intronic
1126785420 15:52174574-52174596 GGGGATGAGGGCCAAAGGGATGG + Intronic
1128323958 15:66711535-66711557 GAGGAGGTGGGACAAAGGGAGGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132895980 16:2229601-2229623 CACGATGTGGGCCACAGTGATGG - Exonic
1134176627 16:12012273-12012295 AGGGATGTGGGGCAAAGTGGTGG + Intronic
1134375906 16:13672977-13672999 GTGTAGGTGGGCTAAAGTCAAGG - Intergenic
1137769807 16:51006954-51006976 TTGGATGAGGGCAAAAATGATGG - Intergenic
1139408073 16:66735443-66735465 GCTGATGTGGTCCAAACTGATGG - Intronic
1140110010 16:71996227-71996249 GGGGAGGTGGGTCAATGTGAGGG - Intronic
1143941247 17:10544276-10544298 GTGGATGTGTGCTAAAGTTGGGG - Intronic
1144070567 17:11667814-11667836 GTGGATGTAGGACAACATGATGG - Intronic
1146458373 17:33024644-33024666 ATGGATGGGGGCCAAGGTCAAGG - Intronic
1147175367 17:38652768-38652790 GTGAATGTGGGCCCAACAGATGG + Intergenic
1149178596 17:53905279-53905301 GGGGCTGTGGGGCAAAGGGAGGG + Intergenic
1152411296 17:80124627-80124649 GTGGGTGAGGGCCAGAGGGAAGG + Intergenic
1152660065 17:81537943-81537965 GTGGATGTGGACGGAAGTGGGGG - Intergenic
1153958680 18:10121879-10121901 GTGGATGGAGGCCAACGTAAAGG + Intergenic
1157400340 18:47382066-47382088 GTGGAGATGGGGCAAAGTGCAGG - Intergenic
1158627442 18:59083674-59083696 ATGTATGTAAGCCAAAGTGACGG + Intergenic
1159028869 18:63210862-63210884 GTGAATGGGGTCCAAAGTGTGGG - Intronic
1159958126 18:74534195-74534217 GTGGCTGTGGGCCCTTGTGATGG - Intergenic
1160144635 18:76353515-76353537 TTGGAGGTGGGCCTAAGGGAAGG + Intergenic
1164588370 19:29491886-29491908 GTGGATGTGGGTGAGAGTGCAGG - Intergenic
1164701873 19:30290830-30290852 GTGGGTGGGGGGCAAAGGGAGGG - Intronic
1165226331 19:34357756-34357778 GGAGATGTGGGCCTAGGTGAGGG + Intergenic
1165905644 19:39192997-39193019 TTGGATGCTGGCCAAAGAGATGG + Intergenic
1166625135 19:44344900-44344922 GTGGTTGTGGGATTAAGTGAGGG - Intronic
926309625 2:11666125-11666147 GTGGCAGTGGGCCAAAGTGGTGG + Intronic
927201371 2:20580063-20580085 CTGGGTGTGGGCCAAATTGTGGG - Intronic
927994972 2:27478217-27478239 GTGGAGGTGGGCAAAGGTCATGG - Intronic
929658202 2:43755303-43755325 GTGGAAAAGGGCCAAAGTGAGGG - Intronic
931091398 2:58890566-58890588 GTGGATGGGGGGCAAGGGGAGGG - Intergenic
931458135 2:62427987-62428009 GTTTATTTGAGCCAAAGTGAGGG - Intergenic
932029304 2:68166935-68166957 GTGGATATGGCCAAAAGTGAGGG - Intronic
934035981 2:88088783-88088805 GGGGATGTGAGCCAGAGAGAGGG + Intronic
935722879 2:105995141-105995163 GTGGCTGGTGTCCAAAGTGAGGG + Intergenic
937971562 2:127552893-127552915 GAGGATGTGGGGCAAAGAGGAGG + Intronic
940586959 2:155664860-155664882 GGGGGTGGGGGGCAAAGTGAGGG - Intergenic
941887017 2:170538570-170538592 GTGGATGAGGGGCAAGGTGAAGG - Intronic
943883680 2:193182946-193182968 GGGGATGGGGGACAGAGTGAGGG - Intergenic
945993065 2:216412712-216412734 GAGGAAGTGGGCCAATGGGAAGG + Intronic
946992108 2:225345130-225345152 GTGGATGTGGAGGAAAGGGAAGG - Intergenic
1171233258 20:23504462-23504484 GTTTATTTGGGCCAAGGTGAAGG - Intergenic
1172644038 20:36458900-36458922 TTGGATGTGGGTGAGAGTGAAGG + Intronic
1173548276 20:43915254-43915276 GTGGCTGTGGGTCACTGTGACGG - Intronic
1173697934 20:45037296-45037318 GTGGATGTGTGCAAAAGGGGAGG + Intronic
1173846405 20:46191427-46191449 GGGGATGGGGGCCAATGGGAAGG + Intronic
1174351908 20:49974492-49974514 CTCGTTGTGGGCCATAGTGAAGG + Intergenic
1174670916 20:52306916-52306938 AAGGATGAGGGCCAAAGAGAAGG + Intergenic
1175468436 20:59208706-59208728 GCTGATGGGGGCAAAAGTGAGGG - Intronic
1175779698 20:61674524-61674546 GTGGAGGTGGCCCCAAGTGGTGG - Intronic
1176091200 20:63319345-63319367 GGGGCTGTGGGCCACATTGAGGG + Intronic
1177481693 21:21697927-21697949 CTGGATGTGTGACAAAGTCAAGG + Intergenic
1178510394 21:33200547-33200569 ATGGATGTGTGCCAATGTGGTGG - Intergenic
1181714426 22:24713771-24713793 GTGGAGGTTGGCCACAGAGATGG + Intergenic
1181776215 22:25161704-25161726 GTGGATGTGGGACAGACTGGGGG + Intronic
1182561296 22:31161397-31161419 GGAGATGTAGGCTAAAGTGATGG - Intronic
1183011120 22:34947433-34947455 GTGTAGCTGGGCCACAGTGAGGG + Intergenic
1183012199 22:34955927-34955949 GGGGATGGGGGCCAAGGGGAAGG + Intergenic
1183890757 22:40926436-40926458 GTGCATGTGGGCCGCAGTGAAGG - Exonic
1184994751 22:48197326-48197348 GTGTATGTGGGACAGGGTGAGGG - Intergenic
949718805 3:6964992-6965014 ATGGATCTGGGCCAGAGTGGTGG - Intronic
952974550 3:38682641-38682663 GTGGGTTGGGGCCAGAGTGATGG + Intergenic
953801371 3:46026354-46026376 GTTGAGGTGGGCCACAGAGATGG - Intronic
956141088 3:66147717-66147739 GTGTATGTGGTGCAAAGGGAAGG - Intronic
956856266 3:73277887-73277909 GTGGACATGGGCCCAAGTTATGG + Intergenic
960768322 3:121163422-121163444 GTGGATGGGGGGCAAGGAGAGGG + Intronic
961512121 3:127409540-127409562 GTGGATGTGGGGTGAAGGGAAGG - Intergenic
964423111 3:156525288-156525310 GTGGAGGTGGAACATAGTGATGG + Intronic
967131633 3:186476319-186476341 GTGAGGGTGGGCCTAAGTGATGG + Intergenic
968762419 4:2449565-2449587 GTGGATGTGGGTGAAGGGGAGGG - Intronic
970168683 4:13266601-13266623 GGAGATGTTGGCCAAAGTGTAGG - Intergenic
970725663 4:19041558-19041580 GTGGATCTAGGCTAAAGTGGTGG - Intergenic
973615133 4:52670619-52670641 GTGGAAGTGACCCATAGTGAGGG - Intergenic
976416502 4:84782528-84782550 GGGGAAGTGGGCCAAGGGGAGGG - Intronic
979253236 4:118586836-118586858 GTGAATGGGGGCAAAAGTGATGG - Intergenic
979268691 4:118733873-118733895 GGTCATGTGAGCCAAAGTGAGGG - Intronic
979799037 4:124884225-124884247 ACGGAAGTGGGCCAAAGTTAGGG + Intergenic
980192790 4:129545964-129545986 TTGGATGTGGGCCAATGGGACGG - Intergenic
981134309 4:141192592-141192614 GTGGATGTTGGCCAAAGCATAGG + Intronic
984056397 4:174934817-174934839 TTAGCTGTGGGCCAAATTGAAGG - Intronic
986635513 5:9818546-9818568 CTGGCTGTGGGCCAGGGTGATGG + Intergenic
986860520 5:11921681-11921703 ATAAATGTGGGCAAAAGTGAAGG + Intergenic
991089512 5:62680355-62680377 CTGGAAGTGGGCCAAAGGGCAGG + Intergenic
991192608 5:63893163-63893185 GGGGATGGGGGCCAAGGGGAGGG - Intergenic
991504150 5:67306600-67306622 GTGGTTAAGGGGCAAAGTGAAGG + Intergenic
992108688 5:73471942-73471964 GAGGATCTGGGCCAAAGAAAGGG + Intergenic
994332992 5:98529472-98529494 GTGCATGTGGCCCAAGCTGAAGG + Intergenic
994548221 5:101197727-101197749 GTGCATGGGGGGCAAAGGGAGGG - Intergenic
995750891 5:115452189-115452211 GCTGATGAGGGCCATAGTGAAGG - Intergenic
996994878 5:129683743-129683765 TTGGAGGTGGGCAAAAGTGGCGG - Intronic
998461077 5:142310625-142310647 GTGGAAATGGGCTACAGTGAGGG + Exonic
998680592 5:144462293-144462315 ATGAATGTGGCCAAAAGTGATGG - Intronic
998860650 5:146440284-146440306 ATGGATATGGGCAGAAGTGATGG + Intergenic
999355697 5:150928630-150928652 GTGGTGCTGTGCCAAAGTGAGGG + Intergenic
1000821506 5:165990286-165990308 GTGCATGTAGACCAAAGTGGGGG - Intergenic
1001160536 5:169308691-169308713 GTGGATGTGAGTGAAAGTGCTGG + Intergenic
1001807633 5:174601341-174601363 GTGGTTGTCGGGTAAAGTGATGG - Intergenic
1002685406 5:181005504-181005526 GTGGACGTGGGACAAAATGTAGG + Exonic
1004312530 6:14558256-14558278 GGGGATGGGGGCCAAGGGGAGGG - Intergenic
1004848211 6:19669271-19669293 GTGGATGTGGGGCTAAGGGATGG - Intergenic
1005273542 6:24191857-24191879 ATGGATGTGGGGCAAATGGATGG + Intronic
1008086589 6:47251792-47251814 CTGGATTTGGGGGAAAGTGAGGG - Intronic
1013460742 6:110372769-110372791 GTTAATGTGGGCAAAAGTCAAGG - Intergenic
1013852086 6:114528196-114528218 TTGCATGTGGACCAAAGTAAGGG - Intergenic
1014597372 6:123361372-123361394 GTGGGTGGGGGGCAAAGGGAGGG + Intronic
1016097801 6:140059624-140059646 GTGCCTGTGTGCCCAAGTGATGG - Intergenic
1016574896 6:145558877-145558899 GTGGAGGTGGGGAAAAGGGATGG - Intronic
1017001897 6:150003049-150003071 GTGCATTTGGGGCAAAGTAACGG + Intergenic
1017028598 6:150201787-150201809 GTGGAGGTGGTACAAAGTGCAGG + Intronic
1017054265 6:150423889-150423911 GGGCATGTGGGCCACAGTGGGGG - Intergenic
1018356287 6:163021103-163021125 GAGAATCTGGGCTAAAGTGATGG - Intronic
1019971694 7:4546571-4546593 ATGGTTGGGGGGCAAAGTGAGGG - Intergenic
1022632724 7:32100915-32100937 TTGTATTTAGGCCAAAGTGATGG - Intronic
1024226124 7:47328021-47328043 GAGGATGTGGGCCAGACAGAGGG + Intronic
1029168155 7:98610625-98610647 GTGGGTGTGGGGAAAAATGATGG + Intergenic
1030501938 7:110370202-110370224 GTGGCTGAGGGACAAATTGAAGG - Intergenic
1031446895 7:121865745-121865767 GTGGTGGTGGGGCAAAGAGAAGG + Intergenic
1035313862 7:157986245-157986267 TTGGATGTGAGGCAACGTGAAGG + Intronic
1037031872 8:14117725-14117747 GGGGATGTGGGACTAAGGGAGGG - Intronic
1038731495 8:30132090-30132112 CTGGGTGTGGGCCCAGGTGAGGG + Exonic
1041051404 8:53938383-53938405 GTGGATGGGGGACTAAGGGAGGG + Intronic
1041157092 8:54998822-54998844 GTGGATTTGGGTTAAAGTTAGGG - Intergenic
1041704071 8:60826737-60826759 GTGGATGGGGGACAACGAGATGG - Intronic
1043027328 8:75086209-75086231 TTGGATGGAGGACAAAGTGAAGG - Intergenic
1043253342 8:78103657-78103679 GGGGATGTGGGGCAAGGGGAGGG - Intergenic
1043393012 8:79809382-79809404 CTGGGTGTGGGGCAAAGTCAAGG + Intergenic
1045362225 8:101443337-101443359 ATGGTTGTGGGGCAAAGAGAAGG - Intergenic
1045884933 8:107084447-107084469 GTGGATGTGGGCCAGAGTGTAGG + Intergenic
1046931354 8:119844975-119844997 GTGGATGAGGGCCAAGTTAAGGG + Intronic
1052742001 9:32402510-32402532 GTGGATGTGGGACATAGGGAGGG + Intronic
1053361074 9:37486868-37486890 GTGGATGTGGGAGGGAGTGAGGG + Intronic
1053362200 9:37496320-37496342 ATGGGTGCTGGCCAAAGTGATGG + Intronic
1054717066 9:68567167-68567189 ATGGATGTGGGCCTATGTCAAGG - Intergenic
1055567927 9:77587621-77587643 GGGGAGGTGGGACAAAGGGATGG + Intronic
1056319041 9:85419449-85419471 GTGGATGAGAGCCAAAGGGTGGG + Intergenic
1056733201 9:89183287-89183309 GTGAATGTGGGAGAGAGTGAGGG - Intergenic
1057443133 9:95096335-95096357 GTGGAGGTGGGAGAAAGGGAGGG + Intergenic
1058571403 9:106349392-106349414 ATGGATGTGGGGAAAAGGGAAGG - Intergenic
1058969958 9:110072168-110072190 GTTGATGTGGGCAAAAATGAGGG + Intronic
1059655590 9:116354697-116354719 GTTGATGTTGGCCTGAGTGAGGG - Intronic
1061194811 9:129102026-129102048 CTGGATGTGTACCACAGTGACGG - Exonic
1062282338 9:135757635-135757657 GAGGAGGAGGGACAAAGTGAAGG + Intronic
1062370002 9:136233662-136233684 GTGGATGTGGTCAAAAGGGAGGG + Intronic
1187018913 X:15359535-15359557 GTGGGTGGGGGGCAAAGGGAGGG - Intronic
1188112660 X:26210261-26210283 GAGGATGTGGGGAAAAGGGAAGG - Intergenic
1188164251 X:26842680-26842702 GTGGATGTGGGCAAAGAAGAAGG + Intergenic
1188577757 X:31673198-31673220 GTGGAGCTGGGAGAAAGTGACGG + Intronic
1190157558 X:48006097-48006119 GTGGATGTGGGCCAAAGTGAGGG + Intronic
1190173328 X:48128982-48129004 GTGGATGTGGGCCAAAGTGAGGG + Intergenic
1193405009 X:81089877-81089899 GGGGATGTGGGGCAAGGGGATGG + Intergenic
1194264745 X:91740686-91740708 GTGGAGGGGGGACAAAGTTAAGG - Intergenic
1194981819 X:100449429-100449451 GTGGAGCTGGGCCAAGATGATGG + Intergenic
1199794340 X:151180210-151180232 GAGGATCTGGACCAAAGTGCTGG + Exonic
1199973130 X:152875252-152875274 TTGGATGTGGGGCTAAGGGAGGG + Intergenic
1200340044 X:155386685-155386707 GTGGATGTGGTGAAAAGGGACGG - Intergenic
1200346426 X:155454003-155454025 GTGGATGTGGTGAAAAGGGACGG + Intergenic
1201682700 Y:16666428-16666450 GATGATGTGGGTCAAAGTGATGG - Intergenic