ID: 1190177314

View in Genome Browser
Species Human (GRCh38)
Location X:48161625-48161647
Sequence GGCCAGCTGGTCCTTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190177314_1190177316 -7 Left 1190177314 X:48161625-48161647 CCAACAGGAAGGACCAGCTGGCC No data
Right 1190177316 X:48161641-48161663 GCTGGCCTCTGCTGTGTTACTGG No data
1190177314_1190177320 7 Left 1190177314 X:48161625-48161647 CCAACAGGAAGGACCAGCTGGCC No data
Right 1190177320 X:48161655-48161677 TGTTACTGGGGCCACTTGCATGG 0: 3
1: 5
2: 4
3: 18
4: 128
1190177314_1190177318 -5 Left 1190177314 X:48161625-48161647 CCAACAGGAAGGACCAGCTGGCC No data
Right 1190177318 X:48161643-48161665 TGGCCTCTGCTGTGTTACTGGGG No data
1190177314_1190177317 -6 Left 1190177314 X:48161625-48161647 CCAACAGGAAGGACCAGCTGGCC No data
Right 1190177317 X:48161642-48161664 CTGGCCTCTGCTGTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190177314 Original CRISPR GGCCAGCTGGTCCTTCCTGT TGG (reversed) Intergenic
No off target data available for this crispr