ID: 1190181190

View in Genome Browser
Species Human (GRCh38)
Location X:48194189-48194211
Sequence TATTACGCATGAAAGGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 11, 2: 2, 3: 4, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190181179_1190181190 30 Left 1190181179 X:48194136-48194158 CCCACGGTTAGGGTCATTATCAA 0: 2
1: 2
2: 3
3: 9
4: 32
Right 1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG 0: 1
1: 11
2: 2
3: 4
4: 64
1190181182_1190181190 0 Left 1190181182 X:48194166-48194188 CCCCTGGAAGTCTGCGACCCGTT 0: 1
1: 1
2: 5
3: 9
4: 37
Right 1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG 0: 1
1: 11
2: 2
3: 4
4: 64
1190181180_1190181190 29 Left 1190181180 X:48194137-48194159 CCACGGTTAGGGTCATTATCAAA 0: 2
1: 2
2: 3
3: 4
4: 51
Right 1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG 0: 1
1: 11
2: 2
3: 4
4: 64
1190181183_1190181190 -1 Left 1190181183 X:48194167-48194189 CCCTGGAAGTCTGCGACCCGTTT 0: 1
1: 1
2: 7
3: 6
4: 28
Right 1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG 0: 1
1: 11
2: 2
3: 4
4: 64
1190181184_1190181190 -2 Left 1190181184 X:48194168-48194190 CCTGGAAGTCTGCGACCCGTTTA 0: 1
1: 1
2: 5
3: 3
4: 35
Right 1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG 0: 1
1: 11
2: 2
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190181190 Original CRISPR TATTACGCATGAAAGGTGGG AGG Exonic
912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG + Intronic
917339550 1:173961078-173961100 TCTTCCGGATGAAAGGTAGGAGG + Exonic
920168735 1:204055808-204055830 TATCAGGAATGAAGGGTGGGGGG - Intergenic
1063746027 10:8882535-8882557 TTTTATGTTTGAAAGGTGGGGGG - Intergenic
1069597194 10:69679887-69679909 TATTGCTCATGGAGGGTGGGTGG - Intergenic
1096017541 12:48291336-48291358 AATTAGGAATGAAGGGTGGGGGG + Intergenic
1101194407 12:102368311-102368333 CATTACCCAGGAAAGGCGGGGGG - Intergenic
1102214513 12:111150873-111150895 TATTTCGCAGCAATGGTGGGAGG + Intronic
1120129251 14:80785702-80785724 TTTTAGGCCAGAAAGGTGGGGGG + Intronic
1126100863 15:45117454-45117476 TTTTACAGATGAAAAGTGGGGGG + Exonic
1131711767 15:95063058-95063080 CATTAAGGGTGAAAGGTGGGAGG - Intergenic
1133974523 16:10591153-10591175 TTTTAAGCATGGAAAGTGGGTGG + Intergenic
1139559987 16:67735820-67735842 GATGACGCAGGAAAGGAGGGAGG + Intronic
1146643819 17:34563114-34563136 CTTTACGCATGAAAGGAGAGAGG + Intergenic
1148155645 17:45424100-45424122 TGTGAGGCATGAAAGGAGGGGGG - Intronic
1149007744 17:51822972-51822994 TATTAAGCAGCAAAAGTGGGTGG - Intronic
1157890394 18:51410313-51410335 TATTTAGCATGGAAGGTGTGGGG - Intergenic
1159384512 18:67706384-67706406 TCTTACACATGAAATGTTGGGGG + Intergenic
1160361093 18:78279796-78279818 TATTAGGCATTGAAGGTGTGAGG - Intergenic
1166239083 19:41477532-41477554 AATTACACATGAGATGTGGGTGG - Intergenic
927502854 2:23593819-23593841 TTTTACACATAAGAGGTGGGAGG + Intronic
927603316 2:24463487-24463509 AATTTCGAATGACAGGTGGGAGG - Intergenic
927952457 2:27181599-27181621 TATTACTCTTTAAAGGTCGGGGG - Intergenic
937079136 2:119127857-119127879 TATGACACCAGAAAGGTGGGAGG + Intergenic
937472355 2:122185165-122185187 TATTGCACATGCAAAGTGGGAGG - Intergenic
939482751 2:142770202-142770224 AATTACTCATGAAAGGAGTGGGG + Intergenic
944006194 2:194909866-194909888 TATTACTCAACCAAGGTGGGTGG + Intergenic
945182303 2:207104450-207104472 TATCACCCATTGAAGGTGGGTGG - Intronic
1170037282 20:12003047-12003069 TATTACCCAAGAAAAGGGGGTGG - Intergenic
1172684195 20:36740976-36740998 TATTAAAAAAGAAAGGTGGGGGG + Intronic
1172684332 20:36742440-36742462 TATTAAGAAAGAAAGGTGGCGGG - Intronic
1176956436 21:15109688-15109710 TATAAAGCTTGAAAAGTGGGGGG + Intergenic
1178261298 21:31102074-31102096 TATTATACATAAGAGGTGGGGGG - Intergenic
951222839 3:20086698-20086720 TATTAGAAATGAAAGGTGGGTGG + Intronic
951435990 3:22665508-22665530 CATAACTCATGAAGGGTGGGGGG - Intergenic
972943432 4:44224950-44224972 TCTTACCAATGAAATGTGGGCGG - Intronic
977128853 4:93207831-93207853 TAATACTCATGTAAGGAGGGTGG - Intronic
979624728 4:122831477-122831499 TATTACCAAAGAGAGGTGGGGGG - Intronic
989034864 5:37160035-37160057 TATTATGCATAAAAGGTGATAGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
998955601 5:147435090-147435112 TATTAATTAAGAAAGGTGGGGGG + Intronic
999682887 5:154076297-154076319 TTTTAAGCAAGAAAGGAGGGAGG - Intronic
999897639 5:156052338-156052360 TATTACAGATGAAAGGGGAGAGG + Intronic
1009437888 6:63638239-63638261 TATTACTTATAAAAGTTGGGAGG + Intronic
1014199123 6:118589267-118589289 TATTGTACATGAAAGTTGGGAGG - Intronic
1014492427 6:122078823-122078845 TATTATGCATGATAAATGGGAGG + Intergenic
1016617748 6:146072361-146072383 AATAATGCATGAAAGGAGGGAGG - Intronic
1016669374 6:146684152-146684174 TATGAAGCATGAGAGGTGGAGGG - Intronic
1020379975 7:7533370-7533392 TATTAAGCCTGAAAGGGTGGTGG - Intronic
1022629818 7:32074738-32074760 TTGTTTGCATGAAAGGTGGGTGG + Intronic
1024548980 7:50544691-50544713 TATTACTTATGCAAGGAGGGAGG - Intronic
1024780415 7:52841376-52841398 TATTTTGAATGAAAGGAGGGTGG - Intergenic
1027990030 7:85346441-85346463 TATTATGCATGGGAGGTGGGGGG - Intergenic
1029681678 7:102115819-102115841 TGTTCTGCATGAAAGATGGGCGG - Intronic
1035936422 8:3846510-3846532 TATTTCACAGGAATGGTGGGTGG + Intronic
1042775067 8:72421075-72421097 TATTACTCATGAAAGATGTGTGG - Intergenic
1046950505 8:120015644-120015666 TAATAGGCAAGAAAGATGGGAGG + Intronic
1048458523 8:134600821-134600843 AATTACTCTTCAAAGGTGGGAGG + Intronic
1052453330 9:28661470-28661492 TATTAAGCATGTAAGTTTGGGGG + Intronic
1053141052 9:35682946-35682968 TATTAAGCAGCAAAGGAGGGTGG + Intronic
1054912573 9:70467414-70467436 TATTACTCATAAAGGCTGGGTGG - Intergenic
1055807727 9:80115924-80115946 TATAACGCAGTTAAGGTGGGAGG + Intergenic
1059897203 9:118879605-118879627 TATTACGTATGAAATTTTGGGGG - Intergenic
1185692787 X:2170128-2170150 TTTTACTTAGGAAAGGTGGGAGG - Intergenic
1188440375 X:30210085-30210107 TCTGACGCATGAAAGGTAGCTGG + Intergenic
1188705855 X:33329102-33329124 AATTACTAATGAAAGTTGGGAGG + Intronic
1190170963 X:48111273-48111295 TATTACGCATGAAAAGTGAGAGG - Intergenic
1190177089 X:48159284-48159306 TATTACGCATGAAAGGTGAGAGG - Intergenic
1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG + Exonic
1190188826 X:48258549-48258571 TATTACACATGAAAGGTGGGAGG - Exonic
1190190913 X:48276768-48276790 TATTACACATGAAAGGTGGGAGG + Intronic
1190194230 X:48303664-48303686 TATTACACATGAAAGGTGGGAGG + Intergenic
1190200104 X:48354059-48354081 TATTACGCATGAAAGATGGGAGG + Exonic
1190203799 X:48385365-48385387 TACTACGCATGAAAGGTGGGAGG - Exonic
1190206737 X:48410038-48410060 TACTACGCATGAAAGGTGGGAGG + Exonic
1190655699 X:52610597-52610619 TATTATGCATGAAAGGTGAGAGG + Intergenic
1190657715 X:52626305-52626327 TATTACACATGAAAGGTGGGAGG - Intergenic
1190660744 X:52652312-52652334 TATTATGCATGAAAGGTGGGAGG + Exonic
1190666901 X:52704557-52704579 TATTACACATGAAAGGTGGGAGG + Exonic
1190672517 X:52753851-52753873 TATTACACATGAAAGGTGGGAGG - Exonic
1201862539 Y:18615197-18615219 TATTACAAATGTAATGTGGGAGG + Intergenic
1201870784 Y:18705183-18705205 TATTACAAATGTAATGTGGGAGG - Intergenic