ID: 1190182024

View in Genome Browser
Species Human (GRCh38)
Location X:48200616-48200638
Sequence CTTTGAAAGGTCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42066
Summary {0: 1, 1: 23, 2: 431, 3: 5077, 4: 36534}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190182024 Original CRISPR CTTTGAAAGGTCAAGGTGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr