ID: 1190191298

View in Genome Browser
Species Human (GRCh38)
Location X:48279528-48279550
Sequence AAATGTAAGCAGAGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190191298_1190191304 -1 Left 1190191298 X:48279528-48279550 CCCTCCAACCTCTGCTTACATTT No data
Right 1190191304 X:48279550-48279572 TTTGAAAGGGAATCTAAGTGTGG 0: 7
1: 0
2: 4
3: 21
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190191298 Original CRISPR AAATGTAAGCAGAGGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr