ID: 1190191348

View in Genome Browser
Species Human (GRCh38)
Location X:48279812-48279834
Sequence CGCTGCAGCCTTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190191342_1190191348 -2 Left 1190191342 X:48279791-48279813 CCTGGGCTCAAGGGATCCTCCCG 0: 136
1: 3726
2: 30857
3: 87108
4: 222638
Right 1190191348 X:48279812-48279834 CGCTGCAGCCTTGGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190191348 Original CRISPR CGCTGCAGCCTTGGGACTAC AGG Intergenic
No off target data available for this crispr