ID: 1190200214

View in Genome Browser
Species Human (GRCh38)
Location X:48354919-48354941
Sequence CTGTCGGGCTTTAATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 7, 3: 3, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190200203_1190200214 30 Left 1190200203 X:48354866-48354888 CCACGGCTAACTGACAGAACATG 0: 1
1: 7
2: 4
3: 3
4: 59
Right 1190200214 X:48354919-48354941 CTGTCGGGCTTTAATGCTGCTGG 0: 1
1: 0
2: 7
3: 3
4: 50
1190200207_1190200214 -2 Left 1190200207 X:48354898-48354920 CCTAGCTTCACCCCTGCCACACT 0: 1
1: 4
2: 10
3: 46
4: 371
Right 1190200214 X:48354919-48354941 CTGTCGGGCTTTAATGCTGCTGG 0: 1
1: 0
2: 7
3: 3
4: 50
1190200206_1190200214 2 Left 1190200206 X:48354894-48354916 CCTTCCTAGCTTCACCCCTGCCA 0: 1
1: 1
2: 1
3: 32
4: 346
Right 1190200214 X:48354919-48354941 CTGTCGGGCTTTAATGCTGCTGG 0: 1
1: 0
2: 7
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190200214 Original CRISPR CTGTCGGGCTTTAATGCTGC TGG Intronic
905298628 1:36971034-36971056 CTCTCTGGCTTTACTGCTGTGGG + Intronic
907868643 1:58423189-58423211 CTGTCTGGCTTTTAAGCTGAAGG - Intronic
908203295 1:61819749-61819771 CAGTAGCGCTTCAATGCTGCAGG + Intronic
913349517 1:117842424-117842446 CTGTCGGTCCTGAATTCTGCAGG + Intergenic
916637898 1:166693480-166693502 CTATGTGGCTGTAATGCTGCAGG + Intergenic
917180256 1:172288459-172288481 TTGTTGGTCTTTAATGCAGCAGG + Intronic
1067155860 10:43780600-43780622 CTGTCAGGCTTCTCTGCTGCAGG + Intergenic
1069554523 10:69389133-69389155 ATGCCTGGCTTGAATGCTGCCGG - Intronic
1071252452 10:83834326-83834348 CTGTCGCAATTTGATGCTGCAGG + Intergenic
1071293624 10:84204057-84204079 CTGTGGGCCTTTGGTGCTGCTGG - Intronic
1072000951 10:91195175-91195197 AAGTGGGCCTTTAATGCTGCAGG - Intronic
1076415621 10:130286094-130286116 CTGCTGGGCTTTACTGCTCCAGG + Intergenic
1080383154 11:31794870-31794892 CTGTCGGGATATAATGCTCTTGG - Intronic
1080983785 11:37437318-37437340 CTCTCAGGCTTTAATGCCTCTGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1096591093 12:52659664-52659686 CTGCCAGTCTCTAATGCTGCTGG + Intergenic
1103323065 12:120102748-120102770 GTGCCGGGCTTTCATGCTGTGGG + Intronic
1106684195 13:32040469-32040491 CAGTCTGGCTTTAATGGTGCAGG - Intronic
1108494728 13:51013903-51013925 CTGTTGGGCTGTAATGCAGGAGG - Intergenic
1109330344 13:60921377-60921399 CTGTTGGGCATTGCTGCTGCTGG + Intergenic
1114134664 14:19834340-19834362 CTGTCGGACATGAATTCTGCAGG + Intergenic
1130928770 15:88405356-88405378 CAGTCTGGCTTTAGTGCTGTGGG + Intergenic
1130942147 15:88519834-88519856 ATGTGGGCCCTTAATGCTGCAGG + Intronic
1138706363 16:58919917-58919939 CTGTCAGGCTTCTTTGCTGCAGG + Intergenic
1139490921 16:67285527-67285549 CTGTCGGGCTTACATGGCGCAGG - Exonic
1141867004 16:86757301-86757323 GTGTGGGGATTTCATGCTGCTGG - Intergenic
1159350402 18:67265309-67265331 CTGTAGGGTTTTCTTGCTGCAGG - Intergenic
941254629 2:163213332-163213354 CTGTCAGGAATTAAGGCTGCTGG + Intergenic
941813005 2:169772582-169772604 CTCTCCTGGTTTAATGCTGCTGG + Intronic
948059607 2:235033152-235033174 CTGTGGTGCTTGAATGCAGCAGG - Intronic
1169234257 20:3916871-3916893 CTGTTGGGCTTTGTTGCTGTTGG + Intronic
1170920282 20:20671810-20671832 CTGAAGGGCTTTCCTGCTGCAGG + Intronic
1176926674 21:14758518-14758540 CTGTCCTGCTTAAATGCCGCTGG - Intergenic
1178719399 21:34995037-34995059 CTTTCGGGCTTAAATGCCACGGG - Intronic
1179059909 21:37970314-37970336 CTGTGAGGCTTTAATGGTCCAGG + Intronic
955926495 3:64010929-64010951 CTGTCCAGGTTTATTGCTGCCGG - Exonic
962261950 3:133916024-133916046 CTGTGGGGCTTTCACGCTTCTGG + Intergenic
968103818 3:195987112-195987134 CTGTCAGCCTTTACTGTTGCAGG - Intergenic
980192123 4:129538367-129538389 CAGGTGGGCCTTAATGCTGCTGG - Intergenic
983796903 4:171875326-171875348 CTGTTGGGTTTTTATTCTGCTGG + Intronic
994655274 5:102585101-102585123 CTGTTGGGCATTAATTCTGAAGG - Intergenic
1005861581 6:29906635-29906657 GTGTGGGGCTTAACTGCTGCAGG - Intergenic
1021838655 7:24705034-24705056 CTGTGGTGCTTTCATGATGCTGG + Intronic
1035974134 8:4288125-4288147 CAGTCAAACTTTAATGCTGCAGG - Intronic
1037287255 8:17314597-17314619 GTGTGTGGCTTTTATGCTGCAGG - Intronic
1038857916 8:31352990-31353012 CAATCGGGCTTGAATTCTGCTGG - Intergenic
1040329721 8:46379656-46379678 CTGGCGGGCTCTAAAGCCGCAGG + Intergenic
1049347041 8:142144692-142144714 CAGCCAGGCTCTAATGCTGCAGG + Intergenic
1050424780 9:5501924-5501946 CTGTCGGTCCTAAATTCTGCAGG + Intergenic
1190176958 X:48158254-48158276 CAGTAGGGCTTCAATGCTGCTGG - Intergenic
1190181297 X:48195028-48195050 CAGTAGAGCTTTAATGCTGCTGG + Exonic
1190194336 X:48304518-48304540 CAGTAGGGCTTTAATGCTGCTGG + Intergenic
1190200214 X:48354919-48354941 CTGTCGGGCTTTAATGCTGCTGG + Intronic
1190203663 X:48384362-48384384 CAGTAGGGCTTTAATGCTGCTGG - Intronic
1190206873 X:48411042-48411064 CAGTAGGGCTTTAATGCTGCTGG + Intronic
1190654396 X:52598296-52598318 CAGTAGGGCTTTAATGCTGCTGG - Intergenic
1190655809 X:52611428-52611450 CAGTAGGGCTTTAATGCTGCTGG + Intergenic
1190667025 X:52705419-52705441 CAGTAGGGCTTTAATGCTGCTGG + Intronic
1190672393 X:52752989-52753011 CAGTAGGGCTTTAATGCTGCTGG - Intronic
1195071607 X:101286314-101286336 CTGTGGGGTTTTTATACTGCTGG - Intronic
1195289151 X:103414629-103414651 CTGTCGGACCTGAACGCTGCAGG - Intergenic