ID: 1190200533

View in Genome Browser
Species Human (GRCh38)
Location X:48356965-48356987
Sequence ACTTTTTCGCAGTGGCGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190200533_1190200541 29 Left 1190200533 X:48356965-48356987 CCTTGTCGCCACTGCGAAAAAGT No data
Right 1190200541 X:48357017-48357039 ATCTCTCTGAAGACTGTTCCTGG No data
1190200533_1190200538 -9 Left 1190200533 X:48356965-48356987 CCTTGTCGCCACTGCGAAAAAGT No data
Right 1190200538 X:48356979-48357001 CGAAAAAGTGGGTGGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190200533 Original CRISPR ACTTTTTCGCAGTGGCGACA AGG (reversed) Intergenic
No off target data available for this crispr